VIRAL VECTOR, ISOLATED POLYNUCLEOTIDE, USE OF A RECOMBINANT ADENO-ASSOCIATED VIRUS (AAV) AND METHOD

专利摘要:
Protein delivery using adeno-associated virus (aav) vectors Compositions, systems, and method for delivering proteins of interest using adeno-associated virus (aav) vectors are disclosed in this report.
公开号:BR112013021494B1
申请号:R112013021494-5
申请日:2012-02-21
公开日:2021-09-08
发明作者:Alejandro Benjamin Balazs；David Baltimore
申请人:California Institute Of Technology；
IPC主号:

专利说明:

RELATED ORDERS
[001] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Applications Nos. 61/445,449, filed February 22, 2011; 61/550,123, filed October 21, 2011; and 61/598,728, filed February 14, 2012. These priority requests are fully and expressly incorporated by reference in this report. STATEMENT SPONSORED BY THE FEDERAL GOVERNMENT
[002]This invention was made with government support under HHSN266200500035C granted by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO THE SEQUENCE LISTING
[003] This application has been filed together with a Sequence Listing in electronic format. The Sequence Listing is provided as a file titled SEQLISTING.TXT, created on February 21, 2012, which is 148 Kb. The information in the electronic format of the Sequence Listing is incorporated in its entirety in this report by reference. Fundamentals Field of Invention
[004] The present application refers, in general, to the fields of immunology and gene release. More particularly, the application relates to compositions, systems and methods for producing proteins of interest, such as antibodies. Description of Related Art
[005] Despite significant efforts, no effective vaccine has been developed for the human immunodeficiency virus (HIV) to date. Many antibodies have been identified as capable of neutralizing more circulating HIV strains. Although substantial effort has focused on designing immunogens capable of inducing de novo antibodies that would target similar epitopes, it remains unclear whether a conventional vaccine will be able to induce analogs of widely existing neutralizing antibodies. As an alternative to immunization, the vector-mediated gene transfer described in this report can be used to create secretion of widely circulating neutralizing antibodies.
[006] Existing methods aimed at the production of genetically encoded therapeutic proteins result in only limited levels of gene expression. For example, previous efforts to create humoral immunity using adeno-associated virus (AAV) based vectors resulted in modest antibody production (Lewis et al., J. Virol. 76:8769-8775 (2002)), which was subsequently improved through the use of alternative capsids (Fang et al. Nature Biotechnol., 23: 584-590 (2005)) and self-complementary AAV vectors (scAAV) (McCarty., Mol. Ther., 16: 1648-1656 (2008) ) that increase the expression in the load capacity expenditure. Recently, scAAV vectors have been used to target the expression of simian immunodeficiency virus (SIV) neutralizing immunoadhesins consisting of small, artificially fused antibody fragments ( Johnson et al., Nature Med., 15(8): 901-906 ( 2009)). However, the effectiveness of this prophylaxis was limited by an endogenous immune response directed against immunoadhesin proteins. Furthermore, the lack of effectiveness of existing AAV-based methods can be attributed to the inability of AAV vectors to transmit sequences greater than approximately 4800 base pairs in length. Dong et al., Human Gene Therapy, 7:2101 - 2112 (1996). This limitation of AAV vectors makes it difficult to design vectors containing a gene encoding a therapeutic protein as well as expression promoting elements to account for high levels of production, particularly in vivo. Therefore, there is an urgent need for the development of compact vectors and systems capable of expressing genes efficiently. summary
[007] Some modalities disclosed in this report provide a viral vector, where the viral vector comprises: a 5' inverted terminal repeat (ITR) of adeno-associated virus (AAV) and a 3' AAV ITR; a promoter; a restriction site downstream of the promoter to allow insertion of a polynucleotide encoding one or more proteins of interest, and a post-transcriptional regulatory element downstream of the restriction site, where the promoter, restriction site and regulatory element post-transcription are located downstream of the 5' AAV ITR and upstream of the 3' AAV ITR.
[008] In some embodiments, the viral vector further comprises a polynucleotide inserted into the restriction site and operably linked to the promoter, where the polynucleotide comprises an encoding region of a protein of interest.
[009] In some embodiments, the polynucleotide comprises a signal peptide sequence immediately upstream of the coding region of the protein of interest. In some embodiments, the signal peptide is selected from the group consisting of an interferon signal peptide, a human growth hormone signal peptide, an erythropoietin (EPO) signal peptide, a granulocyte colony-stimulating factor signal peptide (G-CSF), an insulin signal peptide, and any combination thereof.
In some embodiments, the viral vector comprises a nucleotide sequence having at least about 70%, at least about 80%, at least about 90% sequence identity, or more to the Kozak consensus sequence.
[0011] In some embodiments, the protein of interest is selected from the group consisting of full-length antibodies, growth hormones (GHs), insulin-like growth factors (IGFs), G-CSFs, erythropoietins (EPOs), insulins, Fab antibody fragments, scFV antibody fragments, hemophilia-related clotting proteins, dystrophin, lysosomal acid lipase, phenylalanine hydroxylase (PAH), glycogen storage disease-related enzymes, and any variants thereof.
[0012] In some embodiments, the protein of interest is a virus neutralizing antibody. In some embodiments, the virus neutralizing antibody is a neutralizing antibody to a human immunodeficiency virus (HIV), a hepatitis C virus (HCV), or an influenza virus. In some embodiments, the neutralizing antibody to HIV is selected from the group consisting of anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, and any variant thereof. In some embodiments, the neutralizing antibody to HCV is selected from the group consisting of anti-HCV AR3A antibody, anti-HCV AR3B antibody, anti-HCV AR4A antibody, and any variant thereof. In some embodiments, the neutralizing antibody to influenza virus is selected from the group consisting of F10 anti-influenza antibody, CR6261 anti-influenza antibody, FI6 anti-influenza antibody, TCN32 anti-influenza antibody, and any variant thereof .
[0013] In some embodiments, the protein of interest is a neutralizing antibody to malaria.
In some embodiments, the promoter comprises cytomegalovirus (CMV) immediate early promoter, chicken beta-actin (CAG) promoter, ubiquitin C promoter (UBC), or any variant thereof. In some embodiments, the promoter comprises a splice donor, a splice acceptor, or any variant thereof. In some embodiments, the splice donor comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5. In some embodiments, the splice acceptor comprises a nucleotide sequence having at least 90% sequence identity. sequence to SEQ ID NO: 6. In some embodiments, the promoter comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the promoter comprises a nucleotide sequence having at least 90 % sequence identity to any one of SEQ ID NOs: 2 to 4.
[0015] In some embodiments, the post-transcriptional regulatory element is a viral post-transcriptional regulatory element. In some embodiments, the viral post-transcriptional regulatory element is woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), hepatitis B virus post-transcriptional regulatory element (HBVPRE), RNA transport element (RTE), or any variant thereof.
[0016] In some embodiments, the viral vector further comprises a transcription termination region downstream of the post-transcriptional regulatory element. In some embodiments, the transcription termination region comprises an SV40 late poly(A) sequence, a rabbit beta-globin poly(A) sequence, a bovine growth hormone poly(A) sequence, or any variant of the above. same.
[0017] In some embodiments, the promoter comprises an intron. In some embodiments, the intron is a synthetic intron comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8.
In some embodiments, the polynucleotide comprises a first coding region for the heavy chain variable region of an immunoglobulin and a second coding region for the light chain variable region of the immunoglobulin. In some embodiments, the first coding region and the second coding region are separated by a 2A sequence. In some embodiments, the 2A sequence is an F2A sequence.
In some embodiments, 5' of the first coding region is fused to a first signal peptide sequence and 5' of the second coding region is fused to a second signal peptide sequence. In some embodiments, the first signal peptide sequence and the second signal peptide sequence are different.
[0020] In some modalities, the region starting at the 5' ITR and ending at the 3' ITR has at least about 2.5 kb.
Some embodiments in this report provide a method for producing a protein of interest in vivo, where the method comprises: providing a recombinant adeno-associated virus (AAV) comprising a nucleotide sequence encoding the protein of interest; and administering the recombinant AAV to the patient, whereby recombinant AAV expresses the antibody in the patient, wherein the nucleotide is at least about 1.4 kb.
[0022] In some embodiments, the protein of interest is an antibody. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is selected from the group consisting of anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, anti-influenza antibody F10, anti-influenza antibody FI6 , influenza TCN32 antibody, anti-influenza antibody CR6261, anti-HCV AR3A antibody, anti-HCV AR3B antibody, anti-HCV AR4A antibody, anti-malarial antibody, and any variant thereof.
In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 9 μg/ml. In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 100 µg/ml. In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 500 µg/ml.
[0024] In some embodiments, recombinant AAV is produced by providing a packaging cell line with a viral vector, helper functions to generate a productive AAV infection, and AAV cap genes, where the viral vector comprises a terminal repeat 5' AAV inverted (ITR), a 3' AAV ITR and a nucleotide sequence encoding the protein of interest; and recovering a recombinant AAV virus from the packaging cell line supernatant.
[0025] In some modalities, the viral vector is the viral vector of any of the viral vectors disclosed in this report.
[0026] Some modalities disclosed in this report provide a method for reducing or inhibiting the risk of infection of a virus in a patient, the method comprising: providing a recombinant adeno-associated virus (AAV) comprising a nucleotide sequence encoding an antibody neutralizing for the virus; and administering the recombinant AAV to the patient, whereby the recombinant AAV expresses the antibody in the patient.
In some embodiments, the method further comprises providing a second recombinant AAV comprising a nucleotide sequence encoding a second neutralizing antibody to the virus.
[0028] In some embodiments, the patient is a mammal. In some modalities, the patient is a human being.
In some embodiments, the neutralizing antibody is a full-length antibody.
[0030] In some modalities, the method reduces the risk of infection in the patient by at least about 5 times compared to patients without treatment with the viral vector. In some modalities, the method reduces the patient's risk of infection by at least about 20-fold compared to patients without viral vector treatment. In some embodiments, the method inhibits viral infection in the patient.
In some embodiments, the antibody is expressed in the patient's serum in the amount of at least about 9 μg/ml. In some embodiments, the antibody is expressed in the patient's serum in the amount of at least about 100 µg/ml. In some embodiments, the antibody is expressed in the patient's serum in the amount of at least about 500 µg/ml.
[0032] In some embodiments, the virus is a human immunodeficiency virus (HIV), a hepatitis C virus (HCV), or an influenza virus.
[0033] In some embodiments, the neutralizing antibody is selected from the group consisting of anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, anti-influenza antibody F10, antibody anti-influenza CR6261, influenza TCN32 antibody, anti-influenza FI6 antibody, anti-HCV AR3A antibody, anti-HCV AR3B antibody, anti-HCV AR4A antibody, and any variant thereof.
In some embodiments, recombinant AAV is administered to the patient by intramuscular injection, intravaginal injection, intravenous injection, intraperitoneal injection, subcutaneous injection, epicutaneous administration, intradermal administration, or nasal administration.
[0035] In some modalities, recombinant AAV is administered to the patient at most once each year. In some modalities, recombinant AAV is administered to the patient at most once every 5 years. In some modalities, recombinant AAV is administered to the patient at most once every 10 years.
Some modalities disclosed in this report provide a method for producing a recombinant adeno-associated virus (AAV), where the method comprises: providing a packaging cell line with a viral construct comprising AAV 5' inverted terminal repeat (ITR) and AAV 3' ITR, helper functions to generate a productive AAV infection, and AAV cap genes; and recovering a recombinant AAV virus from the packaging cell line supernatant.
In some modalities, the AAV cap genes encode a capsid from serotype 1, serotype 2, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, or a variant thereof.
[0038] In some modalities, the viral construct is any one of the viral vectors disclosed in this report.
[0039] In some embodiments, the recombinant AAV is not a self-complementary AAV (scAAV).
Some embodiments disclosed in this report provide an isolated, synthetic or recombinant polynucleotide, where the polynucleotide comprises: a nucleic acid sequence having at least about 90% or more sequence identity to SEQ ID NO: 1. In some embodiments , the polynucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 2 to 4. Brief Description of Drawings
Figure 1A is a graph showing luciferase activities 15 weeks after intramuscular injection of 2x109 GC of AAV2/8 vectors expressing luciferase from a panel of promoters (n = 2). Figure 1B is a schematic presentation of a CASI promoter modality combining the CMV enhancer and chicken β-actin promoter, followed by a splice donor (SD) and splice acceptor (SA) flanking the ubiquitin enhancer region . Figure 1C is a graph showing luciferase activities from CASI-targeted AAV vectors compared to conventional CMV and CAG promoters 8 weeks after intramuscular injection of 1x109 GC of AAV2/8 encoding luciferase targeted by the indicated promoter ( n = 2). Figure 1D is a graph showing luciferase activities 6 weeks post-administration of CMV-targeted AAV vectors with or without WPRE, terminated by the indicated polyadenylation signal (n = 2). Figure 1E is a schematic presentation of an expression cassette for antibody expression comprising the inverted terminal repeats (ITR), the CASI promoter, an IgG1 heavy chain linked to the kappa light chain separated by a self-splicing 2A sequence, a WPRE for enhanced expression, and SV40 late polyadenylation signal. The heavy and light chain antibody V regions are cloned into the vector at the positions indicated in filled boxes.
[0042] Figure 2 is a schematic representation of an AAV vector modality that is within the scope of this application.
Figure 3A is a bar graph showing the comparison of antibody expression in vitro by ELISA after transfection with vectors carrying the antibody transgene shown above with standard or optimized F2A sequences that include a furin cleavage site. Figure 3B is a bar graph showing the comparison of 4E10 antibody expression in vitro by ELISA after transfection with 4E10-bearing vectors with natural or human growth hormone (HGH) derived signal peptides fused to the heavy chain gene, to the light chain gene or both genes. Figure 3C is a bar graph showing the comparison of 4E10 antibody expression in vitro by ELISA after transfection with vectors carrying 4E10 in the standard expression cassette or a cassette in which the splice donors and acceptors have been modified to reduce the potential for extraneous splicing. Figure 3D is a schematic presentation of an exemplary IgG1 transgene that has been optimized for in vitro expression. Highlighted are the heavy and light chain ("SS") signal sequences, the F2A self-processing peptide ("F2A"), and the predicted splice donor and acceptor sites (solid lines in "Constant Heavy Chain Region" and "Constant" Front cover").
[0044] Figure 4A-D shows the neutralization of HIV through antibodies expressed from an optimized expression transgene: b12 (Fig. 4A), 2G12 (Fig. 4B), 4E10 (Fig. 4C) and 2F5 (Fig. 4D) (n = 3, RLU = Relative Luciferase Units).
Figure 5A shows Xenogen images of a representative Rag2/yc mouse 15 weeks after intramuscular injection of 1x1010 copies of AAV2/8 genome expressing luciferase. Figure 5B is a graph showing quantification of luciferase activity by Xenogen imaging of Rag27-yc-/- mice receiving intramuscular injection of 1x1010 or 1x1011 AAV2/8 GC encoding luciferase demonstrates long-term dose-dependent expression (n = 2). Figure 5C is a graph showing the circulating human IgG concentration as measured by total human IgG ELISA in serum samples taken after intramuscular injection of 1x1010 or 1x1011 GC of AAV2/8 expressing 4E10-IgG1 in Rag27-mouse yc7- (n = 2).
[0046] Figure 6 is a graph showing quantification of human IgG by ELISA after intramuscular injection of 1x1011 copies of optimized expression vector genome producing b12-IgG in immunodeficient NOD/SCID/yc (NSG) and Rag2/ yc (Rag2) or immunocompetent C57BL/6 (B6) and Balb/C mice (graph shows mean and standard error, n = 4).
[0047] Figure 7 is a graph showing CD4 cell depletion in humanized HuPBMC-NSG mice after HIV challenge.
[0048] Figure 8A is a graph showing the circulating human IgG concentration as measured by ELISA in serum samples taken 6 weeks after intramuscular injection of vector expressing luciferase or b12-IgG (ND, not detected). Figure 8B shows depletion of CD4 T cells in humanized mice after intraperitoneal challenge with 10 ng of p24 NL4 - 3 in animals that received either AAV2/8 vectors expressing luciferase (left graph) or b12-IgG1 (right graph) 6 weeks earlier (n = 6).
[0049] Figure 9 shows a comparison of protection mediated by various broadly neutralizing antibodies against HIV. Figure 9A shows circulating antibody concentration as measured by total human IgG ELISA in serum samples taken after intramuscular injection of vectors expressing four broadly neutralizing HIV antibodies (n = 8). Figure 9B shows the comparison of the relative efficacy of four broadly neutralizing HIV antibodies in protecting humanized huPBMC-NSG mice against CD4 cell depletion after intravenous HIV challenge with 5 ng of p24 NL4-3 (n = 8). Figure 9C shows detection of HIV p24 by immunohistochemical pigmentation of sections taken from spleens 8 weeks after challenge. Arrows indicate cells marked positive for p24 expression. Scale bar, 40 mm. Figure 9D shows the quantification of immunohistochemical spleen pigmentation denoting the relative frequency of cells expressing p24 in spleens from infected animals. ND, not detected. Asterisks indicate significantly different results from luciferase control mice versus mice expressing antibodies by bilateral t-test (n = 4-6) **P,0.01, ***P,0.0001. Figs. 9A-B show mean and s.e.m.; Fig. 9D shows mean and s.d.
Figure 10 shows serum concentrations of total human IgG and IgG binding to gp120 prior to HIV challenge. Figure 10A is a graph showing concentration of total human antibody produced by engrafted cells and VIP as measured by human IgG ELISA in serum samples taken 5 weeks after intramuscular injection of vectors expressing luciferase or b12 antibody and 3 weeks after adopted transfer of human PBMCs and the day before IV challenge with HIV (n = 8). Figure 10B is a graph showing antibody concentration at the same time point quantified using a gp120-specific ELISA to measure HIV-specific antibody concentration (n = 8).
[0051] Figure 11 are graphs showing b12 antibody-mediated CD4 cell protection over time. CD4 cell depletion in humanized huPBMC-NSG mice as a result of intravenous challenge with the dose of NL4-3 indicated on the far right. Mice expressing luciferase (left graphs) were susceptible to CD4 cell loss, whereas those expressing b12 (right graphs) demonstrated protection from HIV at all doses (n = 8).
Figure 12A is a graph showing expression of b12 over time as a function of dose as determined by total human IgG ELISA in serum samples taken after AAV administration (n = 8). Mice that received the luciferase expression vector exhibited no detectable human antibodies (n = 12). Figure 12B is a graph showing serum b12 concentration one day before challenge, 3 weeks after adopted transfer of human PBMCs, and 15 weeks after intramuscular administration of the indicated dose of AAV, as determined by a gp120-specific ELISA to measure the fraction of antibodies capable of binding HIV (n = 8 to 12). Figure 12C is a graph showing CD4 cell depletion in humanized HuPBMC-NSG mice as a result of intravenous challenge with 10 ng NL4-3 in animals expressing a b12 band demonstrating the minimum dose of antibody needed to protect against infection. Figs. 12A and 12C show mean and standard error, and Fig. 12B shows individual animals and mean (n = 8 - 12).
Figure 13A is a graph showing VRC01 expression over time as a function of dose as determined by total human IgG ELISA in serum samples taken after AAV administration (n = 8). Mice that received the luciferase expression vector exhibited no detectable human antibodies (n = 12). Figure 13B is a graph showing serum VRC01 concentration 1 day before challenge, 3 weeks after adopted transfer of human PBMCs, and 15 weeks after intramuscular administration of the indicated dose of AAV, as determined by a gp120-specific ELISA to measure the fraction of antibodies capable of binding to HIV (n = 8 - 12). Figure 13C is a graph showing CD4 cell depletion in humanized huPBMC-NSG mice as a result of intravenous challenge with 10 ng NL4-3 in animals expressing a VRC01 band, demonstrating the minimum dose of antibody needed to protect against infection. Figs. 13A and 13C show mean and standard error, and Fig. 13B shows individual animals and mean (n = 8 - 12).
[0054] Figure 14 is a graph showing the quantification of human IgG in serum by ELISA after intramuscular injection of 1x1011 genome (GC) copies of AAV recombinant viruses expressing unmodified b12, F10, or CR6261 antibodies in Balb/C mice (graph shows mean and standard error, n = 8).
Figure 15 shows the increased expression of modified F10 and CR6261 antibodies. Figure 15A is a bar graph comparing b12 antibody with F10 and CR6261 WT sequences compared to chimeric constructs consisting of F10 or CR6261 heavy chain with b12 light chain. Figure 15B is a table listing various light chains of modified b12 and/or 4E10 antibody used in the AAV vector. Figure 15C is a bar graph comparing the expression level of F10 antibody light chain variants consisting of F10 VL sequences fused to b12 and/or 4E10 antibody light chain sequences. Figure 15D is a bar graph comparing the expression level of CR6261 antibody light chain variants consisting of CR6261 VL sequences fused to b12 and/or 4E10 antibody light chain sequences.
[0056] Figure 16A is a graph showing the quantification of human IgG in serum by ELISA after intramuscular injection of 1x1011 GC of the optimized expression vector producing b12, F10, or CR6261 antibodies in Balb/C mice (the graph shows mean and standard error, n = 6). Figure 16B is a graph showing neutralizing activity of sera taken from mice given b12, F10, or CR6261 antibodies expressing VIP, as measured against five influenza strains (PR/8, CA/09, SI/06, VN /04, JP/57) using a GFP reporter assay. Values are calculated as the fold dilution of serum that resulted in 50% neutralization of influenza infection. The dashed line represents the lowest dilution tested (20-fold) and values below this line are extrapolated from the curve fit or are plotted along the axis to represent no detectable neutralization activity.
[0057] Figure 17A is a graph showing the circulating human IgG concentration as measured by total human IgG ELISA in serum samples taken 5 weeks after intramuscular injection of vector expressing b12, F10, or CR6261 and two days before the viral challenge. Figure 17B is a graph showing observed weight loss in Balb/C mice after intranasal challenge with 1x104 PFU of influenza CA/09 in animals that received control expressing VIP (b12) or F10-IgG (n = 8). Figure 17C is a graph showing the correlation of weight loss 4 days after challenge with CA/09 and CR6261-IgG concentration. d, Weight loss observed in Balb/C mice after intranasal challenge with 5x104 PFU of SI06 in animals that received control expressing VIP (b12) or F10-IgG (n = 8). Figure 17D is a graph showing the survival rate in Balb/C mice expressing b12 and F10 after intranasal PR/8 challenge. Figure 17E is a graph showing observed weight loss in Balb/C mice after intranasal challenge with 1000 PFU PR/8 in animals that received control expressing VIP (b12) or F10 (n = 8). Figures 17F-G are graphs showing in vitro neutralization of five influenza strains (PR/8, CA/09, SI/06, VN/04, JP/57) as detected by GFP reporter assays using taken sera from animals that received recombinant AAV expressing b12, F10 or CR6261, after challenge with CA/09 (Fig. 17F) or SI06 (Fig. 17G). Values are calculated as the fold dilution that resulted in 50% neutralization of influenza infection. The dashed line represents the lowest dilution tested (20-fold dilution) and values below this line are extrapolated from the curve fit or are plotted along the axis to represent no detectable neutralization activity.
[0058] Figure 18A is a graph showing quantification of luciferase expression by Xenogen imaging from young (3 months) or old (12 months) NOD/SCID/YC-/-(NSG) mice after intramuscular injection of 1x1011 vector GC expressing luciferase (n = 8). Figure 18B is a graph showing the quantification of human IgG by ELISA in the serum of young (3 months) or old (12 months) NSG mice after intramuscular injection of 1x1011 GC from vector expressing F10-IgG (n = 8) . Figure 18C are graphs showing survival (left) and weight loss (right) of 3-month old NSG mice that received recombinant AAV expressing luciferase or F10-IgG, after intranasal challenge with 1000 PFU of influenza PR/8 (n = 6 - 8). Figure 18D are graphs showing survival (left) and weight loss (right) of 12-month old NSG mice that received recombinant AAV expressing luciferase or F10-IgG, after intranasal challenge with 1000 PFU of influenza PR/8 ( n = 4 - 6). Figure 18E shows hematoxylin and eosin pigmentation of representative lung sections taken from 3-month old NSG mice that received luciferase or F10-IgG expressing VIP 5 days after challenge with 1000 PFU of influenza PR/8 (bar scale = 100 microns). Figure 18F is a graph showing the ordinal score denoting inflammation as quantified by a trained pathologist (0 = no inflammation, 5 = maximum inflammation). Figure 18G is a graph showing the quantification of influenza RNA in lung tissues as a function of time as animals were sacrificed for analysis.
Figure 19A is a schematic representation of the low dose mucosal HIV challenge regimen used in Example 12. Each week, mice were bled and then challenged with p24 50 ng JR-CSF via non-abrasive intravaginal administration of inoculum as indicated by the solid arrows. Figure 19B is a graph showing the depletion of circulating CD4 cells over time as a result of HIV infection as measured by flow cytometry. Figure 19C is a graph showing HIV plasma viral load at the time of sacrifice after the 13 intravaginal challenges as measured by the Abbott RealTime HIV-1 Viral Load qPCR Assay. The detection limit for this assay was 200 copies/ml. Undetected samples were plotted at detection limit.
Figure 20 is a graph showing the quantification of human IgG in serum by ELISA after administration of AAV recombinant viruses expressing B12, AR3A and AR3B antibodies. Detailed Description
[0061] In the following detailed description, reference will be made to the accompanying drawings, which form a part of this report. The illustrative embodiments described in the detailed description, drawings, and claims are not limiting. Other modalities may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented in this report. It will be readily understood that aspects of the present disclosure, as generally described in this report, and illustrated in the Figures, can be arranged, replaced, combined, and designed in a wide variety of different configurations, all of which are explicitly considered and form part of this disclosure. .
[0062] The present application provides viral vectors useful in the production of recombinant adeno-associated viruses (AAVs), and recombinant AAVs capable of expressing one or more proteins of interest in an appropriate medium, for example, in a cell, a tissue, a organ, or a patient transfected with the recombinant AAVs. Also disclosed in this report are methods for making and using recombinant AAVs. For example, recombinant AAVs can be used to produce a protein of interest in vivo, ex vivo, or in vitro. In some embodiments, expression of the protein of interest can be used to diagnose, prevent, or treat one or more diseases or disorders, such as to reduce or inhibit the risk of viral infections.
[0063] In some embodiments, the viral vector comprises an AAV 5' inverted terminal repeat (ITR) and a 3' AAV ITR, a promoter, a restriction site downstream of the promoter to allow insertion of a polynucleotide encoding one or more proteins of interest, and a post-transcriptional regulatory element downstream of the restriction site, where the promoter, restriction site, and post-transcriptional regulatory element are located downstream of the 5' AAV ITR and upstream of the AAV 3' ITR. The viral vector can be used, for example, to express one or more proteins of interest (eg antibodies). For example, the viral vector can include a polynucleotide that encodes one or more anti-HIV antibodies, anti-HCV antibodies, anti-influenza antibodies, or combinations thereof. The viral vector can, for example, be used to produce high level protein(s) of interest (eg antibodies) in a patient for diagnostic or therapeutic purposes. Definitions
[0064] Unless otherwise defined, technical and scientific terms used in this report have the same meaning as commonly understood by a person of ordinary skill in the art to which this invention belongs. See, for example, Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989). For purposes of the present invention, the following terms are defined below.
[0065] As used in this report, the term “vector” refers to a polynucleotide construct, typically a plasmid or a virus, used to transmit genetic material to a host cell. Vectors can be, for example, viruses, plasmids, cosmids, or phage. A vector, as used in this report, can be made up of DNA or RNA. In some embodiments, a vector is made up of DNA. An "expression vector" is a vector that is capable of directing the expression of a protein encoded by one or more genes carried by the vector when it is present in the appropriate medium. Vectors are preferably capable of autonomous replication. Typically, an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and a gene is "operably linked to" the promoter.
[0066] As used in this report, the term "operably linked" is used to describe the connection between regulatory elements and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. A gene or coding region is "operably linked to" or "operably linked to" or "operably associated with" the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element. For example, a promoter is operably linked to a coding sequence if the promoter effects transcription or expression of the coding sequence.
[0067] The term "construct," as used in this report, refers to a recombinant nucleic acid that has been generated for the purpose of expressing a specific nucleotide sequence, or that is to be used in the construction of other recombinant nucleotide sequences.
[0068] As used in this report, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to any nucleic acid, whether composed of phosphodiester bonds or modified bonds, such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate , carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sultone bonds, and combinations of such links. The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine, and uracil).
The term "regulatory element" and "expression control element" are used interchangeably and refer to nucleic acid molecules that can influence the expression of an operably linked coding sequence in a particular host organism. These terms are widely used for and cover all elements that promote or regulate transcription, including promoters, core elements required for the basic interaction of RNA polymerase and transcription factors, upstream elements, enhancers, and response elements (see, eg Lewin, "Genes V" (Oxford University Press, Oxford) pages 847 - 873). Exemplary regulatory elements in prokaryotes include promoters, operator sequences, and a ribosome binding site. Regulatory elements that are used in eukaryotic cells may include, without limitation, transcriptional and translational control sequences, such as promoters, enhancers, splicing signals, polyadenylation signals, terminators, protein degradation signals, internal ribosome entry element ( IRES), 2A sequences, and the like, which provide and/or regulate expression of a coding sequence and/or production of an encoded polypeptide in a host cell.
[0070] As used in this report, 2A sequences or elements refer to small peptides introduced as a linker between two proteins, allowing for autonomous intraribosomal self-processing of polyproteins (See, for example, de Felipe. Genetic Vaccines and Ther. 2:13 (2004) ); deFelipe et al. Traffic 5:616 - 626 (2004)). These short peptides allow the co-expression of multiple proteins from a single vector. Many 2A elements are known in the art. Examples of 2A sequences that can be used in the methods and system disclosed in this report, without limitation, include 2A sequences from foot-and-mouth disease virus (F2A), equine rhinitis A virus (E2A), Thosea asigna virus (T2A), and porcine tescovirus-1 (P2A), as described in US Patent Publication No. 20070116690.
[0071] As used in this report, the term “promoter” is a nucleotide sequence that allows the binding of RNA polymerase and directs the transcription of a gene. Typically, a promoter is located in the 5' non-coding region of a gene, close to the transcriptional start site of the gene. Sequence elements within promoters that function to initiate transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including humans). A promoter can be inducible, repressible, and/or constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, such as a change in temperature.
[0072] As used in this report, the term "enhancer" refers to a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer from the transcription start site.
[0073] As used in this report, the term "antibody" is used in the broadest sense and specifically covers human, non-human (eg murine) and humanized (including full-length monoclonal antibodies), polyclonal antibodies, multispecific monoclonal antibodies (eg, bispecific antibodies), and antibody fragments as long as they exhibit the desired biological activity. Various antibodies can be expressed using the system and method disclosed in this report. "Antibodies" and "immunoglobulins" are usually heterotetrameric glycoproteins, composed of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by a disulfide bond. The number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes. Each heavy chain comprises a variable domain (VH), followed by a number of constant domains. Each light chain comprises a variable domain at one end (VL) and a constant domain at its other end. The constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the variable domain of the light chain is aligned with the variable domain of the heavy chain. Although antibodies exhibit specific antigen-binding specificity, immunoglobulins include antibodies and other antibody-like molecules that lack antigen specificity. Polypeptides of the latter type are, for example, produced at low levels by the lymphatic system and at increased levels by myelomas.
[0074] As used in this report, the term "variant" refers to a polynucleotide (or polypeptide) having a sequence substantially similar to a reference polynucleotide (or polypeptide). In the case of a polynucleotide, a variant may have deletions, substitutions, additions of one or more nucleotides at the 5' end, 3' end, and/or one or more internal sites compared to the reference polynucleotide. Sequence similarities and/or differences between a variant and the reference polynucleotide can be detected using standard techniques known in the art, for example, polymerase chain reaction (PCR) and hybridization techniques. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, using site-directed mutagenesis. In general, a variant of a polynucleotide, including but not limited to a DNA, can be at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polynucleotide, as determined by sequence alignment programs known to those of skill in the art. In the case of a polypeptide, a variant may have deletions, substitutions, additions of one or more amino acids compared to the reference polypeptide. Sequence similarities and/or differences between a variant and the reference polypeptide can be detected using standard techniques known in the art, for example, Western blot. In general, a variant of a polypeptide can be at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the polypeptide as determined by sequence alignment programs known to skilled technicians.
As used in this report, the term "transfection" refers to the introduction of a nucleic acid into a host cell, such as by contacting the cell with a recombinant AAV virus, as described below.
[0076] As used in this report, the term “transgene” refers to any nucleotide or DNA sequence that is integrated into one or more chromosomes of a target cell through human intervention. In some embodiments, the transgene comprises a polynucleotide that encodes a protein of interest. The polynucleotide encoding the protein is generally operably linked to other sequences that are useful to obtain the desired expression of the gene of interest, such as transcriptional regulatory sequences. In some embodiments, the transgene can further comprise a nucleic acid or other molecule(s) that is (are) used to tag the chromosome where it has been integrated.
[0077]As used in this report, “treatment” refers to a clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The goal of treatment includes, but is not limited to, alleviating or preventing symptoms, reducing or stopping the progression or worsening of a disease, disorder, or condition, and/or remission of the disease, disorder, or condition. “Treatments” refer to therapeutic treatment and prophylactic or preventative measures. Patients in need of treatment include those already affected by an unwanted disease or disorder or physiological condition, as well as those in whom the unwanted disease or disorder or physiological condition must be prevented.
[0078] As used in this report, the term "effective amount" refers to an amount sufficient to effect beneficial or biological and/or clinical desirable results.
[0079] As used in this report, a “patient” refers to an animal that is the object of treatment, observation or experiment. "Animal" includes warm and cold blooded vertebrates and invertebrates such as fish, molluscs, reptiles, and, in particular, mammals. “Mammal,” as used in this report, refers to an individual belonging to the Mammalia class and includes, but is not limited to, humans, domestic and farm animals, zoo animals, sports, and pets. Non-limiting examples of mammals include mice; mice; rabbits; Guinea pigs; dogs; cats; sheep; goats; cows; horses; primates such as monkeys, chimpanzees and gorillas, and in particular humans. In some embodiments, the mammal is a human. However, in some embodiments, the mammal is not a human being. Adeno-associated virus (AAV) vector
Adeno-associated virus (AAV) is a replication-deficient parvovirus, single-stranded DNA genome of which is about 4.7 kb in length, including 145 inverted nucleotide terminal repeats (ITRs). ITRs play a role in the integration of AAV DNA into the host cell genome. When AAV infects a host cell, the viral genome is integrated into the host's chromosome resulting in latent infection of the cell. In a natural system, a helper virus (eg, adenovirus or herpesvirus) provides genes that take into account the production of AAV viruses in the infected cell. In the case of adenoviruses, the E1A, E1B, E2A, E4 and VA genes provide auxiliary functions. After infection with a helper virus, AAV proviruses are rescued and amplified, and AAV and adenoviruses are produced. In the examples of recombinant AAV vectors lacking Rep and/or Cap genes, the AAV may be non-integrating.
AAV vectors that comprise coding regions of one or more proteins of interest, e.g., proteins that are more than 500 amino acids in length, are provided. The AAV vector can include an AAV 5' inverted terminal repeat (ITR), a 3' AAV ITR, a promoter, and a restriction site downstream of the promoter to allow insertion of a polynucleotide encoding one or more proteins. of interest, in which the promoter and restriction site are located downstream of the 5' AAV ITR and upstream of the 3' AAV ITR. In some embodiments, the recombinant AAV vector includes a post-transcriptional regulatory element downstream of the restriction site and upstream of the 3' AAV ITR. In some embodiments, the AAV vectors disclosed in this report can be used as AAV transfer vectors carrying a transgene encoding a protein of interest to produce recombinant AAV viruses that can express the protein of interest in a host cell.
[0082] Viral vector generation can be performed using any suitable genetic engineering techniques well known in the art, including, without limitation, standard techniques of restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing , for example, as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)).
[0083] The viral vector can incorporate sequences from the genome of any known organism. Sequences can be incorporated in their native form or can be modified in any way to achieve a desired activity. For example, sequences can comprise insertions, deletions or substitutions. District Attorney
[0084] Various promoters can be operably linked with a nucleic acid comprising the coding region of the protein of interest in the viral vector disclosed in this report. In some embodiments, the promoter can direct expression of the protein of interest in a cell infected with a virus derived from the viral vector, such as a target cell. The promoter can be naturally or non-naturally occurring.
[0085] Examples of promoters include, but are not limited to, viral promoters, plant promoters, and mammalian promoters. Examples of viral promoters include, but are not limited to, cytomegalovirus (CMV) immediate early promoter, CAG promoter (which is a combination of CMV early enhancer element and chicken beta-actin promoter, described in Alexopoulou et al. BMC Cell Biology 9:2, (2008)), simian virus 40 (SV40) promoter, cauliflower mosaic virus (CaMV) 35S RNA and 19S RNA promoters described in Brisson et al., Nature 1984, 310:511-514, which coats the tobacco mosaic virus (TMV) protein promoter, and any variants thereof. Examples of plant promoters include, but are not limited to, heat shock promoters such as hsp17.5-E or soybean hsp17.3-B described in Gurley et al., Mol. Cell. Biol. 1986, 6:559 - 565, and any variants thereof. Examples of mammalian promoters include, but are not limited to, human elongation factor 1α-subunit (EF1-1a) promoter, human ubiquitin C (UCB) promoter, murine phosphoglycerate kinase-1 (PGK) promoter, and any variants thereof.
[0086] In some embodiments, the promoter is a synthetic promoter comprising at least a portion of the CAG promoter. The CAG promoter portion can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% minus or more sequence identity to SEQ ID NO:3.
[0087] In some embodiments, the promoter comprises a CMV enhancer. In some embodiments, the promoter comprises a UBC enhancer. In some embodiments, the promoter comprises at least a portion of the CMV enhancer. For example, the CMV enhancer can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 2. In some embodiments, the promoter comprises at least a portion of the UCB enhancer. The UCB enhancer can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO:4.
In some embodiments, the promoter is a synthetic CASI promoter having a nucleotide sequence of SEQ ID NO: 1. The synthetic CASI promoter contains a CMV enhancer portion, a chicken beta-actin promoter portion , and a portion of the UBC enhancer. In some embodiments, the promoter can include a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least at least about 99% or more sequence identity to SEQ ID NO:1. In some embodiments, the promoter comprises a nucleic acid sequence that has at least about 90% identity to SEQ ID NO:1. embodiments, the promoter comprises a nucleic acid sequence that has at least about 95% identity to SEQ ID NO: 1. In some embodiments, the promoter comprises a nucleic acid sequence of SEQ ID NO: 1.
[0089] In some embodiments, the vector may include one or more introns to facilitate processing of the RNA transcript in mammalian host cells. A non-limiting example of such an intron is the rabbit β-globin intron. In some embodiments, the intron is a synthetic intron. For example, the synthetic intron can include a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 8. The location of the intron in the vector may vary. In some embodiments, the intron is located between the promoter and the restriction site. In some embodiments, the intron is located within the promoter. In some embodiments, the intron includes a UCB enhancer. The UCB enhancer can comprise a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 4.
[0090] In some embodiments, the promoter is operably linked with a polynucleotide that encodes one or more proteins of interest. In some embodiments, the promoter is operably linked with a polynucleotide that encodes the heavy and/or light chain of an antibody of interest (such as the heavy and light variable region of the antibody). In some embodiments, the promoter is operably linked with a polynucleotide encoding the heavy chain and light chain of an antibody of interest to allow multicistronic expression of the heavy and light chain genes. In some embodiments, a 2A sequence or IRES element is located between the heavy chain variable region coding region and the light chain variable region coding region in the vector to facilitate equivalent expression of each subunit. Alternatively, polynucleotides encoding heavy and light chains can be separately introduced into the target cell in an appropriate viral vector.
[0091] The size of the promoter may vary. Because of the limited packaging capacity of AAV, it is preferred to use a promoter that is small in size, but at the same time allows high level production of the protein(s) of interest in host cells. For example, in some embodiments, the promoter is at most about 1.5 kb, at most about 1.4 kb, at most about 1.35 kb, at most about 1.3 kb, at most about 1.25 kb, at most about 1.2 kb, at most about 1.15 kb, at most about 1.1 kb, at most about 1.05 kb, at most about 1 kb, at most about 800 base pairs, at most about 600 base pairs, at most about 400 base pairs, at most about 200 base pairs, or at most about 100 base pairs.
[0092] The nucleotide sequence of the promoter can also be modified to improve expression efficiency. For example, the promoter can include one or more splice donors, one or more splice acceptors, and/or combinations thereof. In some embodiments, the promoter includes a splice donor and a splice acceptor. In some embodiments, the promoter includes one or more splice donors, and no splice acceptors. In some embodiments, the promoter does not include splice donor, and one or more splice acceptors. For example, in some embodiments, the splice donor can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about of 98%, at least about 99% or more sequence identity to SEQ ID NO: 5. In some embodiments, the splice acceptor can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more sequence identity to SEQ ID NO:6. regulatory elements
[0093] Several post-transcriptional regulatory elements can be used in viral vectors, for example, to increase the expression level of the protein of interest in a host cell. In some embodiments, the post-transcriptional regulatory element may be a viral post-transcriptional regulatory element. Non-limiting examples of viral post-transcriptional regulatory element include woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), hepatitis B virus post-transcriptional regulatory element (HBVPRE), RNA transport element (RTE), and any variants thereof. The WPRE can comprise a nucleic acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99 % or more sequence identity to SEQ ID NO: 7. The RTE may be a rev response element (RRE), for example, a lentiviral RRE. A non-limiting example is the bovine immunodeficiency virus (RRE) rev response element. In some modalities, the RTE is a constitutive transport element (CTE). Examples of CTE include, but are not limited to, Mason-Pfizer Monkey Virus CTE and Avian Leukemia Virus CTE.
[0094] The viral vector described in this report may include a prokaryotic replicon (that is, a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell), such as a host cell bacterial, transformed with it. Such replicons are well known in the art. Furthermore, vectors that include a prokaryotic replicon can also include a gene whose expression confers a detectable marker, such as drug resistance. Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
[0095] In some embodiments, the AAV vector can include a gene for a selectable marker that is effective in a eukaryotic cell, such as a drug resistance selection marker. This selectable marker gene can encode a factor necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that confer resistance to antibiotics or other toxins, for example, ampicillin, neomycin, methotrexate, kanamycin, gentamicin, Zeocin, or tetracycline, complement auxotrophic deficiencies, or supply critical nutrients maintained from the medium.
[0096] The viral vectors disclosed in this report can include various regulatory elements, such as a transcription initiation region and/or a transcriptional termination region. Examples of the transcription termination region include, but are not limited to, polyadenylation signal sequences. Examples of polyadenylation signal sequences include, but are not limited to, Bovine growth hormone (BGH) poly(A), SV40 late poly(A), rabbit beta-globin (RBG) poly(A), thymidine kinase (TK) poly(A) sequences, and any variants thereof. In some embodiments, the transcriptional termination region is located downstream of the post-transcriptional regulatory element. In some embodiments, the transcriptional termination region is a polyadenylation signal sequence. In some embodiments, the transcriptional termination region is the SV40 late poly(A) sequence.
[0097] The viral vectors disclosed in this report may also include one or more A nucleotides immediately after a restriction site downstream of the promoter, where the restriction site allows the insertion of a polynucleotide encoding the protein(s) of interest. For example, one or more A nucleotides are located immediately after the TAA stop codon of the protein of interest after insertion of the polynucleotide encoding the protein of interest into the vector. In some embodiments, one A nucleotide, two A nucleotides, three A nucleotides, or more are located immediately after the restriction site. In some embodiments, one A nucleotide, two A nucleotides, three A nucleotides, or more are located immediately after the TAA stop codon of the protein of interest.
[0098] In some embodiments, viral vectors may include additional sequences that make the vectors suitable for replication and integration in eukaryotes. In other modalities, the viral vectors disclosed in this report may include a transport element that makes the vectors suitable for replication and integration in prokaryotes and eukaryotes. In some embodiments, viral vectors can include additional transcription and translation initiation sequences, such as promoters and enhancers; and additional transcription and translation terminators, such as polyadenylation signals.
[0099] In some embodiments, viral vectors can include a regulatory sequence that allows, for example, the translation of multiple proteins from a single mRNA. Non-limiting examples of such regulatory sequences include internal ribosome entry site (IRES) and 2A autosplicing sequence. In some embodiments, the 2A sequence is a 2A peptide site from foot-and-mouth disease virus (F2A sequence). In some embodiments, the F2A sequence has a standard furin cleavage site. For example, the F2A sequence having a standard furin cleavage site can include a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 9. In some embodiments, the F2A sequence has a modified furin cleavage site. For example, the F2A sequence having a modified furin cleavage site can include a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least less about 98%, at least about 99% or more sequence identity to SEQ ID NO: 10.
Viral vectors may also, in some embodiments, have one or more restriction sites located in proximity to the promoter sequence to provide insertion of nucleic acid sequences encoding one or more proteins of interest and other proteins. Protein of interest
[00101]As used in this report, a “protein of interest” can be any protein, including both naturally occurring and non-naturally occurring proteins. In some embodiments, a polynucleotide encoding one or more proteins of interest can be inserted into the viral vectors disclosed in this report, wherein the polynucleotide is operably linked with the promoter. In some instances, the promoter can direct the expression of proteins of interest in a host cell (eg, a human muscle cell).
[00102]Examples of the protein of interest include, but are not limited to, luciferases; fluorescent proteins (eg GFP); growth hormones (GHs) and variants thereof; insulin-like growth factors (IGFs) and variants thereof; granulocyte colony stimulating factors (G-CSFs) and variants thereof; erythropoietin (EPO) and variants thereof; insulin, such as proinsulin, preproinsulin, insulin, insulin analogues, and the like; antibodies and variants thereof, such as hybrid antibodies, chimeric antibodies, humanized antibodies, monoclonal antibodies; antigen-binding fragment of an antibody (Fab fragments), single-chain variable fragments of an antibody (scFV fragments); dystrophin and variants thereof; coagulation factors and variants thereof; cystic fibrosis transmembrane conductance regulator (CFTR) and variants thereof; and interferons and variants thereof.
[00103] In some embodiments, the protein of interest is a therapeutic protein or variant thereof. Non-limiting examples of therapeutic proteins include blood factors such as β-globin, hemoglobin, tissue plasminogen activator, and clotting factors; colony stimulating factors (CSF); interleukins such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, etc.; growth factors such as keratinocyte growth factor (KGF), stem cell factor (SCF), fibroblast growth factor (FGF such as basic FGF and acidic FGF), hepatocyte growth factor (HGF), factors like insulin-like growth factors (IGFs), bone morphogenetic protein (BMP), epidermal growth factor (EGF), growth differentiation factor-9 (GDF-9), hepatoma-derived growth factor (HDGF), myostatin (GDF) -8), nerve growth factor (NGF), neurotrophins, platelet-derived growth factor (PDGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF- β), and the like; soluble receptors, such as soluble TNF-α receptors, soluble VEGF receptors, soluble interleukin receptors (eg soluble IL-1 receptors and soluble IL-1 type II receptors), soluble TY/δ cell receptors, ligand binding fragments of a soluble receptor, and the like; enzymes such as α-glucosidase, imiglucarase, β-glucocerebrosidase, and alglucerase; enzyme activators such as tissue plasminogen activator; chemokines such as IP-10, interferon-gamma-induced monokine (Mig), Groα/IL-8, RANTES, MIP-1α, MIP-1β, MCP-1, PF-4, and the like; angiogenic agents such as vascular endothelial growth factors (VEGFs, eg, VEGF121, VEGF165, VEGF-C, VEGF-2), transforming growth factor beta, basic fibroblast growth factor, glioma-derived growth factor, angiogenin, angiogenin-2; and the like; anti-angiogenic agents such as a soluble VEGF receptor; protein vaccine; neuroactive peptides such as nerve growth factor (NGF), bradykinin, cholecystokinin, gastin, secretin, oxytocin, gonadotropin releasing hormone, beta-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone releasing hormone, bombesin, dynorphin, warfarin, neurotensin, motilin, thyrotropin, neuropeptide Y, luteinizing hormone, calcitonin, insulin, glucagons, vasopressin, angiotensin II, thyrotropin-releasing hormone, vasoactive intestinal peptide, a sleep peptide, and the like; thrombolytic agents; atrial natriuretic peptide; relaxin; glial fibrillar acid protein; follicle stimulating hormone (FSH); human alpha-1 antitrypsin; leukemia inhibitory factor (LIF); transforming growth factors (TGFs); tissue factors, luteinizing hormone; macrophage activating factors; tumor necrosis factor (TNF); neutrophil chemotactic factor (NCF); nerve growth factor; tissue inhibitors of metalloproteinases; vasoactive intestinal peptide; angiogenin; angiotropin; fibrin; hirudin; IL-1 receptor antagonists; and the like. Some other non-limiting examples of the protein of interest include ciliary neurotrophic factor (CNTF); brain-derived neurotrophic factor (BDNF); neurotrophins 3 and 4/5 (NT-3 and 4/5); glial cell-derived neurotrophic factor (GDNF); aromatic amino acid decarboxylase (AADC); hemophilia-related clotting proteins such as Factor VIII, Factor IX, Factor X; dystrophin or nini-dystrophin; lysosomal acid lipase; phenylalanine hydroxylase (PAH); glycogen storage disease-related enzymes such as glucose-6-phosphatase, acid maltase, glycogen debranching enzyme, muscle glycogen phosphorylase, liver glycogen phosphorylase, muscle phosphofructokinase, phosphorylase kinase (eg, PHKA2), glucose transporter ( for example, GLUT2), aldolase A, β-enolase, and glycogen synthase; lysosomal enzymes (eg, beta-N-acetylhexosaminidase A); and any variants thereof.
[00104] In some embodiments, the protein of interest is an active fragment of a protein, such as any of the aforementioned proteins. In some embodiments, the protein of interest is a fusion protein comprising some or all of two or more proteins. In some embodiments, a fusion protein can comprise all or a portion of any of the aforementioned proteins.
[00105] In some embodiments, the viral vector comprises a polynucleotide comprising coding regions for two or more proteins of interest. The two or more proteins of interest can be the same or different. In some embodiments, the two or more proteins of interest are related polypeptides, for example neutralizing antibodies to the same virus.
[00106] In some embodiments, the protein of interest is a multi-subunit protein. For example, the protein of interest can comprise two or more subunits, or two or more independent polypeptide chains. In some embodiments, the protein of interest can be an antibody. Examples of antibodies include, but are not limited to, antibodies of various isotypes (for example, IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, and IgM); monoclonal antibodies produced by any means known to those skilled in the art, including an antigen-binding fragment of a monoclonal antibody; humanized antibodies; chimeric antibodies; single chain antibodies; antibody fragments such as Fv, F(ab')2, Fab', Fab, Fabb, scFv and the like; as long as the antibody is able to bind the antigen. In some embodiments, the antibody is a full-length antibody. In some embodiments, the protein of interest is not an immunoadhesin.
[00107] In some embodiments, the antibody is an anti-Malaria antibody. Non-limiting examples of anti-Malaria include anti-Malaria antibody 2A10 and anti-Malaria antibody 2C11.
[00108] In some embodiments, the antibody is a viral neutralizing antibody. For example, the antibody can be a neutralizing antibody to HIV, HCV or influenza virus. In some embodiments, the antibody is an anti-HIV neutralizing antibody. In some embodiments, an anti-HIV neutralizing antibody can be, for example, a human neutralizing monoclonal antibody that neutralizes many primary isolates of genetic subtypes other than HIV-1.
[00109] In some embodiments, the antibody is an anti-HCV neutralizing antibody.
[00110] In some embodiments, the antibody is a neutralizing anti-influenza antibody. Non-limiting examples of neutralizing viral antibodies include anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, anti-HIV antibody VRC01, anti-HIV antibody 3BNC60, anti-HIV antibody 3BNC117, NIH45-46 anti-HIV antibody, NIH45-46W anti-HIV antibody, VRC-PG04 anti-HIV antibody, VRC-CH31 anti-HIV antibody, PGT121 anti-HIV antibody, PGT128 anti-HIV antibody, anti-influenza F10 antibody, anti- -influenza CR6261, influenza TCN32 antibody, anti-influenza FI6 antibody, anti-influenza FI6v3 antibody, anti-HCV AR3A antibody, anti-HCV AR3B antibody, anti-HCV AR4A antibody, and any variants thereof.
[00111] As described in this report, the nucleotide sequence encoding the protein of interest can be modified to improve the efficiency of protein expression. The methods that can be used to improve transcription and/or translation of a gene in this report are not particularly limited. For example, the nucleotide sequence can be modified to better reflect the host's codon usage to increase gene expression (eg, protein production) in the host (eg, a mammal). As another non-limiting example for the modification, one or more of the splice donors and/or splice acceptors in the nucleotide sequence of the protein of interest is modified to reduce the potential for extraneous splicing.
[00112]The protein of interest can be of various lengths. For example, the protein of interest can be at least about 200 amino acids, at least about 250 amino acids, at least about 300 amino acids, at least about 350 amino acids, at least about 400 amino acids, at least about 450 amino acids at least about 500 amino acids, at least about 550 amino acids, at least about 600 amino acids, at least about 650 amino acids, at least about 700 amino acids, at least about 750 amino acids, at least about 800 amino acids, or more in length. In some embodiments, the protein of interest is at least about 480 amino acids in length. In some embodiments, the protein of interest is at least about 500 amino acids in length. In some embodiments, the protein of interest is about 750 amino acids in length.
[00113] When it is desired to include coding regions for two or more proteins of interest, two or more individual polypeptide chains, or two or more subunits of a protein of interest in a viral vector, each additional coding region beyond the first is preferably linked to an element that facilitates co-expression of proteins in host cells, such as an internal ribosome entry sequence element (IRES) (US Patent No. 4,937,190), or a 2A element. For example, IRES or 2A elements are preferably used when a single vector comprises sequences encoding each subunit of a multi-subunit protein. In the case that the protein of interest is immunoglobulin with a desired specificity, for example, the first coding region (encoding in the immunoglobulin heavy or light chain) is located downstream of the promoter. The second coding region (encoding the remaining immunoglobulin chain) can be located downstream of the first coding region, and an IRES or 2A element can be disposed between the two coding regions, preferably immediately preceding the second coding region. Incorporating an IRES or 2A element between the sequences of a first and second gene (encoding the heavy and light chains, respectively) can allow the chains to be expressed from the same promoter at about the same level in the cell.
In some embodiments, the protein of interest comprises two or more subunits, for example an immunoglobulin (Ig). The viral vector can include a coding region for each of the subunits. For example, the viral vector can include the coding region for the Ig heavy chain (or the variable region of the heavy chain of Ig) and the coding region for the light chain of Ig (or the variable region of the Ig light chain). In some embodiments, the vectors include a first coding region for the heavy chain variable region of an antibody, and a second coding region for the light chain variable region of the antibody. The two coding regions can be separated, for example, by a 2A auto-processing sequence to allow multi-cistronic transcription of the two coding regions.
[00115] The viral vector can include coding regions for two or more proteins of interest. For example, the viral vector can include the coding region for a first protein of interest and the coding region for a second protein of interest. The first protein of interest and the second protein of interest can be the same or different. In some embodiments, the viral vector can include the coding regions for a third or fourth protein of interest. The third and fourth proteins of interest can be the same or different. The total length of the two or more proteins of interest encoded by a viral vector can vary. For example, the total length of the two or more proteins can be at least about 400 amino acids, at least about 450 amino acids, at least about 500 amino acids, at least about 550 amino acids, at least about 600 amino acids, at least about 650 amino acids, at least about 700 amino acids, at least about 750 amino acids, at least about 800 amino acids, or more.
[00116] The Kozak consensus sequence, Kozak consensus or Kozak sequence, is known as a sequence that occurs in eukaryotic mRNA and has the (gcc)gccRccAUGG consensus, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G." In some embodiments, the vector comprises a nucleotide sequence having at least about 70%, at least about 80%, at least about 90% sequence identity, or more to the Kozak consensus sequence. In some embodiments, the vector comprises a consensus Kozak sequence. In some embodiments, the vector includes a Kozak consensus sequence after the polynucleotide encoding one or more proteins of interest is inserted into the vector, for example, at the restriction site downstream of the promoter. For example, the vector can include a nucleotide sequence of GCCGCCATG (SEQ ID NO: 41), where ATG is the start codon of the protein of interest. In some embodiments, the vector comprises a nucleotide sequence of GCGGCCGCCATG (SEQ ID NO: 42), where ATG is the start codon of the protein of interest.
[00117] The protein of interest can be isolated and purified, if desired, according to conventional methods known to those skilled in the art. For example, a lysate can be prepared from the expression host cells and the lysate can be purified using HPLC, hydrophobic interaction chromatography (HIC), anion exchange chromatography, cation exchange chromatography, size exclusion chromatography, ultrafiltration, electrophoresis in gel, affinity chromatography, and/or other purification techniques. signal peptide sequence
[00118]Various signal peptide sequences can be used in the viral vector disclosed in this report. The signal peptide sequence can be either naturally occurring or non-naturally occurring.
[00119] In some embodiments, a signal peptide can provide secretion from a mammalian cell. Examples of signal peptides include, but are not limited to, the endogenous signal peptide for HGH and variants thereof; the endogenous signal peptide for interferons and variants thereof, including type I, II and III signal peptide interferons and variants thereof; and endogenous signal peptides for known cytokines and variants thereof, such as erythropoietin signal peptide (EPO), insulin, TGF-β1, TNF, IL1-α, and IL1-β, and variants thereof. In some embodiments, the signal peptide is a modified HGH signal peptide. In some embodiments, the nucleotide sequence encoding the signal peptide comprises a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about of 98%, at least about 99%, or more sequence identity to SEQ ID NO: 11. In some embodiments, the nucleotide sequence encoding the signal peptide comprises a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 12.
[00120] In some embodiments, the signal polypeptide for a protein that is different from the protein of interest can be used. In some embodiments, the native signal polypeptide for the protein of interest is used. In some examples, a non-naturally occurring signal peptide may be used.
[00121] Typically, the nucleotide sequence of the signal peptide is located immediately upstream of the coding region of the protein of interest (eg, fused to the 5' of the coding region of the protein of interest) in the vector. In examples where the viral vector includes the coding regions of two or more proteins of interest, the signal peptide sequence can be inserted immediately upstream of one or more between the coding regions. In some embodiments, each of the coding regions has a signal peptide sequence fused at the 5' end. The signal peptide sequence added to each coding region can be the same or different. For example, when the protein of interest has two subunits, the viral vector can include a coding region for one of the subunits and a coding region for the other subunit, and a signal peptide sequence can be inserted immediately upstream of any of the subunits. the coding regions, or two between the coding regions. As another non-limiting example, the viral vector can include a coding region for the heavy chain variable region of an immunoglobulin and a coding region for the variable region of the immunoglobulin light chain, and each of the coding regions is fused to a signal peptide sequence at the 5' end. In some embodiments, the two signal peptide sequences are the same. In some embodiments, the two signal peptide sequences are different.
[00122] In some embodiments, after protein expression and/or secretion, signal peptides can be cleaved from precursor proteins resulting in mature proteins.
[00123] In some embodiments, the region in the viral vector starting from the 5' AAV ITR and ending at the 3' AAV ITR can be released to a host cell and integrate into the host cell genome. The length of this region may vary. For example, the length of this region can be at least about 2kb, at least about 2.25kb, at least about 2.5kb, at least about 2.75kb, at least about 3kb, at least at least about 3.25 kb, at least about 3.5 kb, at least about 3.75 kb, at least about 4 kb, at least about 4.25 kb, or at least about 4.5 kb. In some embodiments, this region is at least about 2.5 kb. In some modalities, this region has about 4.5 kb. In some modalities, the viral vector is not a self-complementary AAV vector (scAAV).
[00124] As disclosed above, viral vectors can include various elements, for example, but not limited to, a promoter, a transgene encoding the protein of interest, a signal peptide sequence, a post-transcriptional regulatory element, an element transcriptional terminal, and a regulatory sequence allowing the translation of multiple proteins from a single mRNA. A skilled technician will assess that a viral vector may include one of these elements, or any combinations of two or more of these elements. For example, the viral vector can include at least one element or a combination of elements listed in Table 1. The convention used in Table 1 is as follows: A = promoter B = transgene C = signal peptide sequence D = post-regulatory element transcriptional E = transcriptional terminal element F = regulatory sequence that allows the translation of multiple proteins from a single mRNA G = Kozak consensus sequence Table 1. Element or combination of elements included in some modalities of the viral vector


[00125] As described above, the nucleotide sequence of each of the elements listed above can be modified to increase the efficiency of expression of the protein of interest in a host cell. In some embodiments where more than one transgene is present in the viral vector, a sequence that can facilitate co-expression of the transgenes can be used. Non-limiting examples of such a sequence include IRES, 2A sequence, and variants thereof.
[00126] Non-limiting exemplary sequences of AAV vectors are provided in SEQ ID NOs: 13 - 30. For example, the nucleotide sequence for an AAV vector, including the CMV promoter, coding sequences for the anti-HIV antibody b12 and SV40 late poly(A) sequence is shown in SEQ ID NO: 13; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, luciferase protein coding sequences, WPRE, and SV40 late poly(A) sequence is shown in SEQ ID NO: 14; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the luciferase protein, WPRE, and rabbit beta-globin (RBG) poly(A) sequence is shown in SEQ ID NO: 15 ; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, luciferase protein coding sequences, WPRE, and bovine growth hormone (BGH) poly(A) sequence is shown in SEQ ID NO: 16; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, anti-HIV b12 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 17; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the anti-HIV 4E10AB antibody, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 18; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the anti-HIV antibody 2G12, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:19; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for anti-HIV 2F5AB antibody, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 20; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, anti-HIV b12 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:21; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, AR3 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:22; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, AR3 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:23; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the VRC01 anti-HIV antibody, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 24; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the anti-influenza antibody TCN32, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 25; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for antibody CR6261, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO: 26; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, F10 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:27; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, AR4 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:28; the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, coding sequences for the FI6 antibody, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:29; and the nucleotide sequence for an AAV vector, including the synthetic CASI promoter, FI6 antibody coding sequences, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:30. In some embodiments, the sequences antibody coding are variants of the wild-type coding sequence of the antibody. As another example, the nucleotide sequence for an AAV vector, including the CASI promoter, WPRE, and SV40 poly(A) sequence is shown in SEQ ID NO:40. In the viral vectors described above, the nucleotide sequence encoding the antibody may be substituted for any other nucleic acid sequence encoding a protein of interest, such as any other nucleic acid sequence encoding an antibody, for example any anti- HIV, anti-HCV, and/or known anti-influenza.
[00127] In some embodiments, the AAV vector comprises a nucleotide sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98 %, at least about 99% or more sequence identity to SEQ ID NOs: 13 - 30. In some embodiments, the AAV vector comprises a nucleotide sequence having at least about 90%, at least about 95% , at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 40.
[00128] In some embodiments, the viral vector includes the CMV promoter and SV40 late poly(A) sequence. In some embodiments, the AAV vector includes the synthetic CASI promoter, WPRE and SV40 late poly(A) sequence. In some embodiments, the AAV vector includes the synthetic CASI promoter, WPRE, and rabbit beta-globin (RBG) poly(A) sequence. In some embodiments, the AAV vector includes the synthetic CASI promoter, WPRE, and bovine growth hormone (BGH) poly(A) sequence. In some embodiments, the AAV vector includes. In some embodiments, the viral vector includes the CAG promoter and SV40 late poly(A) sequence. In some embodiments, the viral vector includes the CAG promoter, WPRE and SV40 late poly(A) sequence. Method for producing recombinant AAVs
[00129] The present application provides methods and materials to produce recombinant AAVs that can express one or more proteins of interest in a host cell. As described in this report, the methods and materials disclosed in this report take into account high production of the proteins of interest, for example, an antibody, such as a full-length antibody.
In some embodiments, methods for producing a recombinant AAV include providing a packaging cell line with a viral construct comprising a 5' inverted terminal repeat (ITR) of AAV and a 3' AAV ITR, as described in this report, helper functions to generate a productive AAV infection, and AAV cap genes; and recovering a recombinant AAV from the packaging cell line supernatant. Various cell types can be used as the packaging cell line. For example, packaging cell lines that can be used include, but are not limited to, HEK 293 cells, HeLa cells, and Vero cells, for example, as disclosed in U.S. Patent Publication No. 20110201088.
[00131] In some embodiments, the packaging cell lineage supernatant is treated by precipitation with PEG to concentrate the virus. In some embodiments, precipitation occurs at no more than about 4°C (eg, about 3°C, about 2°C, about 1°C) for at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 6 hours, at least about 9 hours, at least about 12 hours, or at least about 24 hours. In some embodiments, recombinant AAV is isolated from the PEG-precipitated supernatant by low speed centrifugation followed by a CsCl gradient. Low speed centrifugation can be at about 4000 rpm, about 4500 rpm, about 5000 rpm, or about 6000 rpm for about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes or about 60 minutes. In some embodiments, recombinant AAV is isolated from the PEG-precipitated supernatant by centrifugation at about 5000 rpm for about 30 minutes, followed by a CsCl gradient.
[00132] In some embodiments, the viral construct further comprises a promoter and a restriction site downstream of the promoter to allow the insertion of a polynucleotide encoding one or more proteins of interest, where the promoter and restriction site are located downstream of the 5' AAV ITR and upstream of the 3' AAV ITR. In some embodiments, the viral construct further comprises a post-transcriptional regulatory element downstream of the restriction site and upstream of the AAV 3' ITR. In some embodiments, the viral construct further comprises a polynucleotide inserted into the restriction site and operably linked to the promoter, where the polynucleotide comprises the coding region of a protein of interest. As a skilled artisan will appreciate, any AAV vector disclosed in the present application can be used in the method as the viral construct to produce the recombinant AAV.
[00133] In some embodiments, helper functions are provided by one or more helper plasmids or helper viruses comprising adenoviral helper genes. Non-limiting examples of adenoviral helper genes include E1A, E1B, E2A, E4 and VA, which can provide helper functions for AAV packaging.
[00134] In some embodiments, the AAV cap genes are present on a plasmid. The plasmid may further comprise an AAV rep gene. It is contemplated by the present application that cap genes and/or rep gene from any AAV serotype (including, but not limited to, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and any variants thereof ) can be used in this report to produce the recombinant AAV disclosed in this report to express one or more proteins of interest. In some embodiments, AAV cap genes encode a capsid from serotype 1, serotype 2, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, or a variant thereof.
[00135] In some embodiments, the packaging cell line can be transfected with the helper plasmid or helper virus, the viral construct and the plasmid encoding the AAV cap genes; and recombinant AAV virus can be collected at various time points after co-transfection. For example, recombinant AAV virus can be collected at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, or a time between either between these two time points after co-transfection.
AAV helper viruses are known in the art and include, for example, viruses from the Adenoviridae family and the Herpesviridae family. Examples of AAV helper viruses include, but are not limited to, helper virus SAdV-13 and helper virus of the type SAdV-13 described in U.S. Publication No. 20110201088, helper vectors pHELP (Applied Viromics). A skilled technician will assess that any helper virus or AAV helper plasmid that can provide adequate helper function to AAV can be used in this report.
[00137] The recombinant AAV viruses disclosed in this report can also be produced using any conventional methods known in the art suitable for producing infectious recombinant AAV. In some examples, a recombinant AAV can be produced using a cell line that stably expresses some of the components necessary for AAV particle production. For example, a plasmid (or multiple plasmids) comprising AAV rep and cap genes, and a selectable marker, such as a neomycin resistance gene, can be integrated into the genome of a cell (the packaging cells). The packaging cell line then can be co-infected with a helper virus (eg adenovirus providing the helper functions) and the viral vector comprising the 5' and 3' AAV ITR and the nucleotide sequences encoding the proteins of interest. The advantages of this method are that the cells are selectable and are suitable for large-scale production of recombinant AAV. As another non-limiting example, adenoviruses or baculoviruses rather than plasmids can be used to introduce rep and cap genes into packaging cells. As another non-limiting example, the viral vector containing the 5' and 3' AAV ITRs and rep-cap genes can be stably integrated into the DNA of producer cells, and helper functions can be provided by a wild-type adenovirus to produce the recombinant AAV.
[00138] In some embodiments, the recombinant AAV is not a self-complementary AAV (scAAV).
[00139] As will be evaluated by a qualified technician, any conventional methods suitable for purifying AAV can be used in the modalities described in this report to purify the recombinant AAV. For example, the recombinant can be isolated and purified from packaging cells and/or the supernatant of the packaging cells. In some embodiments, AAV can be purified by a separation method using a CsCl gradient. Furthermore, US Patent Publication No. 20020136710 describes another non-limiting example of a method for purifying AAV, in which AAV was isolated and purified from a sample using a solid support that includes a matrix to which an artificial receptor or molecule. receptor type that mediates AAV binding is immobilized. Applications of viral vectors and recombinant AAV
[00140] The viral vectors disclosed in this report can be used to generate recombinant AAV expressing the protein(s) of interest. The proteins produced by the recombinant AAV generated by the methods and systems described in this report have a wide variety of uses, for example, they may be useful in applications such as diagnostics, therapeutics, research, compound screening, and drug discovery. In vitro protein production
[00141] As a non-limiting example, the recombinant AAV disclosed in this report can be used to produce a protein of interest in vitro, for example, in a cell culture. As a non-limiting example, in some embodiments, a method for producing a protein of interest in vitro, where the method includes providing a recombinant AAV comprising a nucleotide sequence that encodes the protein of interest; and contacting the recombinant AAV with a cell in a cell culture, whereby recombinant AAV expresses the protein of interest in the cell. The size of the nucleotide sequence encoding the protein of interest can vary. For example, the nucleotide sequence can be at least about 1.4kb, at least about 1.5kb, at least about 1.6kb, at least about 1.7kb, at least about 1 .8 kb, at least about 2.0 kb, at least about 2.2 kb, at least about 2.4 kb, at least about 2.6 kb, at least about 2.8 kb, at least at least about 3.0 kb, at least about 3.2 kb, at least about 3.4 kb, or at least about 3.5 kb in length. In some embodiments, the nucleotide is at least about 1.4 kb in length.
[00142] As disclosed above, the protein of interest is in no way limited. For example, the protein of interest can be an antibody, for example a viral neutralizing antibody. The recombinant AAV disclosed in this report can produce high levels of the proteins of interest in vitro.
[00143] In some embodiments, the protein of interest is luciferase or a fluorescent protein (eg, GFP). Recombinant AAV expressing the fluorescent protein can be used to fluorescently label cells allowing visualization of infected cells, eg muscle cells. In vivo protein production
[00144] As a non-limiting example, the recombinant AAV disclosed in this report can be used to produce a protein of interest in vivo, for example, in an animal such as a mammal. Some embodiments provide a method for producing a protein of interest in vivo, where the method includes providing a recombinant AAV comprising a nucleotide sequence that encodes the protein of interest; and administering the recombinant AAV to the patient, whereby recombinant AAV expresses the protein of interest in the patient. The patient can be, in some embodiments, a non-human mammal, for example, a monkey, dog, cat, mouse, or cow. The size of the nucleotide sequence encoding the protein of interest can vary. For example, the nucleotide sequence can be at least about 1.4kb, at least about 1.5kb, at least about 1.6kb, at least about 1.7kb, at least about 1 .8 kb, at least about 2.0 kb, at least about 2.2 kb, at least about 2.4 kb, at least about 2.6 kb, at least about 2.8 kb, at least at least about 3.0 kb, at least about 3.2 kb, at least about 3.4 kb, or at least about 3.5 kb in length. In some embodiments, the nucleotide is at least about 1.4 kb in length.
[00145] As disclosed above, the protein of interest is not limited in any way. For example, the protein of interest can be an antibody, for example a viral neutralizing antibody. The recombinant AAV disclosed in this report can produce high levels of the proteins of interest in vivo. For example, the protein of interest can be expressed in the patient's serum in the amount of at least about 9 µg/ml, at least about 10 µg/ml, at least about 50 µg/ml, at least about 100 µg /ml, at least about 200 μg/ml, at least about 300 μg/ml, at least about 400 μg/ml, at least about 500 μg/ml, at least about 600 μg/ml, at least about 700 μg/ml, at least about 800 μg/ml, at least about 900 μg/ml, or at least about 1000 μg/ml. In some modalities, the protein of interest is expressed in the patient's serum in the amount of about 9 μg/ml, about 10 μg/ml, about 50 μg/ml, about 100 μg/ml, about 200 μg/ ml, about 300 μg/ml, about 400 μg/ml, about 500 μg/ml, about 600 μg/ml, about 700 μg/ml, about 800 μg/ml, about 900 μg/ml , about 1000 μg/ml, about 1500 μg/ml, about 2000 μg/ml, about 2500 μg/ml, or a range between any two between these values. In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 9 µg/ml. In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 100 µg/ml. In some embodiments, the protein of interest is expressed in the patient's serum in the amount of at least about 500 µg/ml. Diagnostic Applications
In some embodiments, the viral vector can be used to generate recombinant AAV expressing one or more proteins of interest useful in detecting a disease or disorder and/or monitoring the progression of a disease or disorder. As used in this report, the term “diagnosis” refers to identifying the presence or absence of or nature of an illness or disorder. For example, when the protein of interest is an antibody, recombinant AAV virus can be used to detect an antigen. The detection of an antigen (eg, an antigen protein, an antigen nucleic acid sequence, an antigen peptide, an antigen lipid, a carbohydrate antigen, and a small molecule antigen) associated with a disease or disorder provides a means of diagnosing the illness or disorder. Such detection methods can be used, for example, for diagnostic detection of the condition, to determine whether a patient is predisposed to a disease or disorder, to monitor the progress of the disease or disorder, or the progress of treatment protocols, to assess the severity of the illness or disorder, to predict the outcome of an illness or disorder and/or seek recovery, or assist in determining an appropriate treatment for a patient. Detection can take place in vitro or in vivo.
Diseases considered for diagnosis in the modalities described in this report include, but are not limited to, any disease in which an antigen, such as an antigen associated with the disease, can specifically bind to the antibody of interest. For example, the antigen can be a tumor antigen, a viral antigen, a microbial antigen, an allergen, and an autoantigen. In some embodiments, the antigen is a viral antigen, such as an HIV antigen. In some embodiments, the antigen is a tumor associated antigen (TAA).
[00148]Many antibodies to diseases are known and can be used in this report as the proteins of interest. For example, anti-cyclic citrullinated peptide antibodies (anti-CCP2) can be used as the protein of interest to detect rheumatoid arthritis.
[00149] In some modalities, the disease that will be diagnosed is a type of cancer, such as, for example, leukemia, carcinoma, lymphoma, astrocytoma, sarcoma, and particularly Ewing's sarcoma, glioma, retinoblastoma, melanoma, Wilm's tumor , bladder cancer, breast cancer, colon cancer, hepatocellular cancer, pancreatic cancer, prostate cancer, lung cancer, liver cancer, stomach cancer, cervical cancer, testicular cancer, kidney cell cancer, and brain cancer.
[00150] In some modalities, the disease that will be diagnosed is associated with infection through an intracellular parasite. For example, the intracellular parasite can be a virus, such as, for example, an adenovirus, cytomegalovirus, Epstein-Barr virus, herpes simplex virus (HSV), human herpesvirus 6, varicella-zoster virus, hepatitis virus, papillomavirus, parvovirus, polyomavirus, measles virus, rubella virus, human immunodeficiency virus (HIV), or human T-cell leukemia virus. In some embodiments, the intracellular parasite can be a bacterium, protozoan, fungus, or a prion. More particularly, the intracellular parasite can be, for example, Chlamydia, Listeria, Salmonella, Legionellosis, Brucella, Coxiella, Rickettsia, Mycobacterium, Leishmania, Trypanasoma, Toxoplasma, and Plasmodium. In some modalities, the disease is malaria.
[00151] In some embodiments, the method for detecting a disease in a patient comprises selecting an antibody to the disease to be detected, inserting a polynucleotide comprising the antibody coding region to the viral vector disclosed in this report, producing a recombinant AAV from the viral vector, infecting the recombinant AAV to the patient, and determining the presence or absence of disease in the patient based on the presence or absence of specific binding between the antibody and its specific antigen.
[00152] Many other uses for antibodies are well known in the art, including therapeutic, diagnostic, judicial, environmental, and commercial applications. For example, an antigen, both in vitro and in vivo, can bind to an antibody of interest. Thus, methods disclosed in this report can be used to detect the presence of an organism and/or an antigen (eg, polypeptides, carbohydrates, lipids or nucleic acids) in a judicial/environmental or tissue/cell sample. In some embodiments, the methods can be used to produce antibody that can allow detection of an enzyme's activated state.
[00153]In some embodiments, the methods can be used to purify proteins, for example, on laboratory or industrial scales. Therapeutic Applications
The recombinant AAV and methods described in this report can be used to express one or more therapeutic proteins to prevent or treat one or more diseases or disorders in a patient.
[00155]Recombinant AAV and methods described in this report can be used to inhibit or reduce the risk of various viral infections. Some embodiments disclose a method of reducing or inhibiting the risk of infection of a virus in a patient, where the method includes providing a recombinant AAV comprising a nucleotide sequence that encodes a neutralizing antibody to the virus; and administering the recombinant AAV to the patient, whereby recombinant AAV expresses the antibody in the patient. Recombinant AAV can produce a high level of viral neutralizing antibody. For example, in some embodiments, recombinant AAV can be expressed in the patient's serum in the amount of at least about 9 µg/ml, at least about 10 µg/ml, at least about 50 µg/ml, at least about 100 μg/ml, at least about 200 μg/ml, at least about 300 μg/ml, at least about 400 μg/ml, at least about 500 μg/ml, at least about 600 μg/ml , at least about 700 μg/ml, at least about 800 μg/ml, at least about 900 μg/ml, or at least about 1000 μg/ml of the viral neutralizing antibody. In some embodiments, viral neutralizing antibody is expressed in the patient's serum in the amount of about 9 μg/ml, about 10 μg/ml, about 50 μg/ml, about 100 μg/ml, about 200 μg/ ml, about 300 μg/ml, about 400 μg/ml, about 500 μg/ml, about 600 μg/ml, about 700 μg/ml, about 800 μg/ml, about 900 μg/ml , about 1000 μg/ml, about 1500 μg/ml, about 2000 μg/ml, about 2500 μg/ml, or a range between any two of these values.
[00156] The method disclosed in this report can, for example, reduce the risk of infection in the patient by at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least at least about 8 times, at least about 10 times, at least about 15 times, at least about 20 times, at least about 25 times, or at least about 30 times compared to patients without the viral treatment. In some modalities, the method can reduce the patient's risk of infection by about 2 times, about 3 times, about 4 times, about 5 times, about 8 times, about 10 times, about 15 times, about 20 times, about 25 times, about 30 times, or a range between any two of these values compared to patients without viral treatment. In some modalities, the method reduces the risk of infection in the patient with viral treatment by at least about 5 times compared to patients without viral treatment. In some modalities, the method reduces the risk of infection in the patient with viral treatment by at least about 20 times compared to patients without viral treatment. In some embodiments, the method prevents viral infection in the patient. In some embodiments, the method inhibits viral infection in the patient.
[00157] Non-limiting examples of viral infection include infections caused by a virus selected from an adenovirus, an Alphaviridae, an Arbovirus, an Astrovirus, a Bunyaviridae, a Coronaviridae, a Filoviridae, a Flaviviridae, a Hepadnaviridae, a Herpesviridae, a Alphaherpesvirinae, a Betaherpesvirinae, a Gammaherpesvirinae, a Norwalk Virus, an Astroviridae, a Caliciviridae, an Orthomyxoviridae, a Paramyxoviridae, a Paramyxoviruses, a Rubulavirus, a Morbillivirus, a Papovaviridae, a Parvophiviridae, an Enteraviridae, a Pi , a Coxsackie virus, a Polio Virus, a Rhinoviridae, a Phycodnaviridae, a Poxviridae, a Reoviridae, a Rotavirus, a Retroviridae, a Type A Retrovirus, an Immunodeficiency Virus, a Leukemia Virus, a Sarcoma virus, an Aviary Sarcoma virus , a Rubiviridae, a Togaviridae, and any combinations thereof. Non-limiting examples of viral infections include human immunodeficiency virus (HIV) infection, hepatitis C virus (HCV) infection, hepatitis B virus (HBC) infection, Esptein Barr virus infection, influenza infection virus, infection by respiratory syncytial virus. In some modalities, the viral infection is a hepatitis C viral infection. In some modalities, the viral infection is an HIV infection. In some modalities, the viral infection is an influenza infection.
[00158]Some modalities provide a method to reduce the risk of viral infection in a patient who has been exposed to a virus (eg, a patient who has come into contact with another patient infected with a virus). Some modalities provide a method to reduce the risk of viral infection in a patient who will be exposed to a virus (for example, a patient who will come into contact with another patient infected with a virus). In some embodiments, a method of preventing viral infection is provided.
[00159] Viral vectors, recombinant AAV and methods described in this report can be used to express one or more therapeutic proteins to treat various diseases. Non-limiting examples of diseases include cancer such as carcinoma, sarcoma, leukemia, lymphoma; and autoimmune diseases such as multiple sclerosis. Non-limiting examples of carcinomas include esophageal carcinoma; hepatocellular carcinoma; basal cell carcinoma, squamous cell carcinoma (various tissues); bladder carcinoma, including transitional cell carcinoma; bronchogenic carcinoma; colon carcinoma; colorectal carcinoma; gastric carcinoma; lung carcinoma, including small cell carcinoma and non-small cell lung carcinoma; adrenocortical carcinoma; thyroid carcinoma; pancreatic carcinoma; breast carcinoma; ovarian carcinoma; prostate carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinoma; cystadenocarcinoma; medullary carcinoma; renal cell carcinoma; tube carcinoma in situ or bile tube carcinoma; choriocarcinoma; seminoma; embryonic carcinoma; Wilm's tumor; cervical carcinoma; uterine carcinoma; testicular carcinoma; osteogenic carcinoma; epithelial carcinoma; and nasopharyngeal carcinoma. Non-limiting examples of sarcomas include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteogenic sarcoma, osteosarcoma, angiosarcoma, endotheliosarcoma, lymphongiosarcoma, lymphangioendotheliosarcoma, synarcoma, sarcoma, sarcoma and other soft tissues, sarcoma, mesocoma, sarcoma, mesocoma and other soft tissues. Non-limiting examples of solid tumors include glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma. Non-limiting examples of leukemias include chronic myeloproliferative syndromes; acute myelogenous leukemias; chronic lymphocytic leukemias, including B-cell CLL, T-cell CLL, prolymphocytic leukemia, and hairy cell leukemia; and acute lymphoblastic leukemias. Examples of lymphomas include, but are not limited to, B cell lymphomas such as Burkitt's lymphoma; Hodgkin's lymphoma; and the like. Other non-limiting examples of diseases that can be treated using AAV vectors, recombinant viruses, and methods disclosed in this report include genetic disorders, including sickle cell anemia, cystic fibrosis, lysosomal acid lipase (LAL) deficiency 1, Tay-Sachs disease, Phenylketonuria, Mucopolysaccharidosis, glycogen storage diseases (GSD, eg GSD types I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, and XIV), Galactosemia, dystrophy muscle (eg Duchenne muscular dystrophy), and hemophilia.
[00160]The amount of the protein of interest expressed in the patient (eg, in the patient's serum) may vary. For example, in some embodiments, the protein can be expressed in the patient's serum in the amount of at least about 9 µg/ml, at least about 10 µg/ml, at least about 50 µg/ml, at least about 100 μg/ml, at least about 200 μg/ml, at least about 300 μg/ml, at least about 400 μg/ml, at least about 500 μg/ml, at least about 600 μg/ml, at least about 700 μg/ml, at least about 800 μg/ml, at least about 900 μg/ml, or at least about 1000 μg/ml. In some modalities, the protein of interest is expressed in the patient's serum in the amount of about 9 μg/ml, about 10 μg/ml, about 50 μg/ml, about 100 μg/ml, about 200 μg/ ml, about 300 μg/ml, about 400 μg/ml, about 500 μg/ml, about 600 μg/ml, about 700 μg/ml, about 800 μg/ml, about 900 μg/ml , about 1000 μg/ml, about 1500 μg/ml, about 2000 μg/ml, about 2500 μg/ml, or a range between any two between these values. A skilled artisan will understand that the level of expression at which a protein of interest is required for the method to be effective may vary depending on non-limiting factors such as the particular protein of interest and the patient receiving treatment, and an effective amount of the protein can be easily determined by a skilled technician using conventional methods known in the art without undue experimentation.
[00161] A skilled technician will assess whether one or more of the viral vectors and recombinant AAV can be used together in the applications described in this report. For example, recombinant AAV viruses expressing different proteins of interest or different subunits of a protein of interest can be administered to the same patient for diagnostic and/or therapeutic purposes. In some embodiments, recombinant viruses are co-administered to the patient. In some embodiments, the recombinant viruses are administered to the patient separately. In some embodiments, a first recombinant AAV expressing a first protein of interest and a second recombinant AAV expressing a second protein of interest can be administered to the patient together or separately, wherein the first protein of interest and the second protein of interest can be both same or different. In some embodiments, the first protein of interest is an anti-HIV neutralizing antibody and the second protein of interest is a different anti-HIV neutralizing antibody. In some embodiments, the first protein of interest is an anti-influenza neutralizing antibody and the second protein of interest is a different anti-influenza neutralizing antibody. In some embodiments, a first recombinant AAV expressing a first subunit of the protein of interest and a second recombinant AAV expressing a second subunit of the protein of interest can be administered to the patient together or separately. Pharmaceutical Composition and Administration Method
[00162] Also disclosed in this report are pharmaceutical compositions comprising the recombinant AAV viruses disclosed in this report and a pharmaceutically acceptable carrier. Compositions can also comprise additional ingredients, such as diluents, stabilizers, excipients, and adjuvants. As used in this report, "pharmaceutically acceptable" carriers, excipients, diluents, adjuvants, or stabilizers are those non-toxic to the cell or patient exposed to them (preferably inert) in the dosages and concentrations used or that have an acceptable level of toxicity, as determined by the qualified practitioner.
[00163] Carriers, diluents and adjuvants can include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides (eg, less than about 10 residues); proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TweenTM, PluronicsTM or polyethylene glycol (PEG). In some embodiments, the physiologically acceptable carrier is an aqueous pH buffered solution.
[00164] Recombinant AAV virus titers that will be administered will vary depending on, for example, the particular recombinant AAV virus, the mode of administration, the goal of treatment, the individual, and the cell type to be targeted, and may be determined by methods standard in technique.
[00165] As will be readily apparent to a person skilled in the art, the useful in vivo dosage of the recombinant virus that will be administered and the particular mode of administration will vary depending on the age, weight, severity of affliction, and species of the treated animal, of the viruses particular recombinant expressing the protein of interest that is used, and the specific use for which the recombinant virus is used. The determination of the effective dosage level, which is the dosage levels necessary to obtain the desired result, can be performed by a person skilled in the art using routine pharmacological methods. Typically, human clinical applications of the products are initiated at lower dosage levels, with the dosage level being increased until the desired effect is obtained. Alternatively, acceptable in vitro studies can be used to establish useful doses and routes of administration of the compositions identified by the present methods using established pharmacological methods.
[00166]Although the exact dosage is determined on a drug-by-drug basis, in most cases, some generalizations regarding dosage can be made. In some embodiments, recombinant AAV expressing a protein of interest can be administered via injection to a patient at a dose of between 1x1011 genome copies (GC) of the recombinant virus per kg of the patient and 1x1013 GC per kg, for example, between 5x1011 GC/kg and 5x1012 GC/kg.
[00167] The recombinant viruses disclosed in this report can be administered to a patient (eg, a human) in need thereof. The route of administration is not particularly limited. For example, a therapeutically effective amount of the recombinant viruses can be administered to the patient by standard routes in the art. Non-limiting examples of the route include intramuscular, intravaginal, intravenous, intraperitoneal, subcutaneous, epicutaneous, intradermal, rectal, intraocular, pulmonary, intracranial, intraosseous, oral, buccal, or nasal. In some embodiments, the recombinant virus is administered to the patient by intramuscular injection. In some embodiments, the recombinant virus is administered to the patient by intravaginal injection. In some embodiments, recombinant AAV is administered to the patient parenterally (eg, by intravenous, intramuscular, or subcutaneous injection), by surface scarification, or by inoculation into a patient's body cavity. Route(s) of administration and serotype(s) of AAV components of the recombinant AAV virus can be easily determined by a person skilled in the art taking into account the infection and/or disease state to be treated and the cells/tissue(s) ) targets that can express the protein of interest. In some embodiments, the recombinant virus is delivered to muscle cells.
[00168] The actual administration of the recombinant AAV virus can be performed through the use of any physical method that will transport the recombinant AAV virus into the patient's target tissue. For example, recombinant AAV virus can be injected into muscle, the bloodstream, and/or directly into the liver. The recombinant AAV virus capsid proteins can be modified such that the recombinant AAV virus is targeted to a particular target tissue of interest, such as muscle and vagina. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations that will be delivered to the muscles via transdermal transport.
[00169] For intramuscular injection, solutions in an adjuvant, such as sesame or peanut oil or in aqueous propylene glycol, can be used, as well as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and the liquid diluent first made isotonic with saline or glucose. Solutions of the recombinant AAV virus as a free acid (the DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. A dispersion of the recombinant AAV virus can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[00170] The recombinant virus that will be used can be used in liquid or lyophilized form (in combination with one or more preservatives and/or suitable protective agents to protect the virus during the lyophilization process). For gene therapy (for example, of neurological disorders that can be ameliorated by a specific gene product), a therapeutically effective dose of the recombinant virus expressing the therapeutic protein is administered to a host in need of such treatment. The use of the recombinant virus disclosed in this report in the manufacture of a drug to induce immunity to, or provide gene therapy to, a host is within the scope of this application.
[00171] In examples where human dosages for recombinant AAV viruses have been established for at least some condition, those same dosages, or dosages that are between about 0.1% and 500%, more preferably between about 25% and 250 % of established human dosage can be used. Where no human dosage is established, as will be the case for newly discovered pharmaceutical compositions, an adequate human dosage may be inferred from ED50 or ID50 values, or other appropriate values derived from in vitro or in vivo studies, as qualified by studies toxicity and efficacy studies in animals.
A therapeutically effective amount of recombinant AAV can be administered to a patient at various time points. For example, recombinant AAV can be administered to the patient before, during, or after infection with a virus. Recombinant AAV can also be given to the patient before, during, or after an illness (eg, cancer) has occurred. In some modalities, recombinant AAV is administered to the patient during cancer remission. In some embodiments, recombinant AAV is administered prior to virus infection for immunoprophylaxis.
[00173] The dosage frequency of recombinant AAV virus may vary. For example, the recombinant AAV virus can be administered to the patient about once every week, about once every two weeks, about once every month, about once every six months, about once every year, about once every two years, about once every three years, about once every four years, about once every five years, about once every six years, about about once every seven years, about once every eight years, about once every nine years, about once every ten years, or about once every fifteen years. In some embodiments, the recombinant AAV virus is administered to the patient at most about once every week, at most about once every two weeks, at most about once every month, at most about once every two weeks. every six months, at most about once every year, at most about once every two years, at most about once every three years, at most about once every four years, at most about once every five years, at most about once every six years, at most about once every seven years, at most about once every eight years, at most about once every nine years years, at most about once every ten years, or at most about once every fifteen years. Example
[00174] Additional modalities are disclosed in more detail in the following examples, which are not intended to limit the scope of the claims. Experimental Materials and Methods
[00175] The following experimental materials and methods were used for Examples 1 to 9 described below. Quantification and Functional Validation of AAV
Purified AAV was quantified by qPCR using the following general procedure. Frozen aliquots of AAV were thawed and diluted ten-fold in digestion buffer containing 10 units of DNase I (Roche) and incubated at 37°C for 30 minutes. The DNase digested viruses were serially diluted and 5 ml of each dilution was used in a 15 μl qPCR reaction with PerfeCTa SYBR Green SuperMix, ROX (Quanta Biosciences) and the designated primers against the CMV enhancer (5' CMV: AACGCCAATAGGGACTTTCC ( SEQ ID NO: 31) and 3' CMV: GGGCGTACTTGGCATATGAT (SEQ ID NO: 32)) or the luciferase transgene (5' Luc: ACGTGCAAAAGAAGCTACCG (SEQ ID NO: 33) and 3' Luc: AATGGGAAGTCACGAAGGTG (SEQ ID NO: 34) ) Samples were run in duplicate on an Applied Biosystems 7300 Real Time PCR System. The following cycling conditions were used: one cycle of 50°C for 2 minutes, one cycle of 95°C for 10 minutes, 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds Virus titer was determined against a standard curve generated using an XhoI/NheI purified DNA fragment cut from the luciferase expression vector pVIP or a standard frame consisting of purified AAV2/8 expressing 4E10 antibody previously titrated against standard DNA.
[00177]To validate the functional activity of each lot of titrated virus, in vitro infection assays were performed using 293T cells and the antibody concentration was measured in the cell supernatant. Twenty-four hours before infection, 12-well plates were seeded with 500K cells in 1 ml of medium. Two hours before infection, the medium was replaced with 500 µl per well of fresh medium. Genome copies (1011) of each virus were added to each well and allowed to infect for 6 days. Supernatants were removed and quantified for total IgG production by ELISA. mouse strains
Immunodeficient NOD/SCID/yc (NSG), immunocompetent C57BL/6 (B6) and Balb/C mice were obtained from the Jackson Laboratory. Rag2/yc immunodeficient mice were obtained from A. Berns. Intramuscular AAV injection and bioluminescent imaging
[00179] Previously titrated virus aliquots were thawed slowly on ice and diluted in TFB2 to obtain the predetermined dose in a volume of 40 μl. The mice were anesthetized by inhalation with isoflurane and a single 40 μl injection was administered into the gastrocnemius muscle with a 28G insulin syringe. At various times after vector administration, mice were bled to determine serum antibody concentration or visually represented using a Xenogen IVIS 200 Series (Caliper Life sciences) imaging system. For imaging, mice were anesthetized by inhalation with isoflurane and given 100 μl of 15 mg ml-1 D-luciferin (Ouro Biotechnology) via intraperitoneal injection. Images were taken between 5 and 10 minutes after D-luciferin injection. Quantification of antibody production by ELISA
For the detection of total human IgG, ELISA plates were coated with 1 µg per well of anti-human IgG-goat Fc antibody (Bethil) for 1 hour. Plates were blocked with 1% BSA (KPL) in TBS for at least 2 hours. Samples were incubated for 1 hour at room temperature in TBST containing 1% BSA (KPL), then incubated for 30 minutes with HRP-conjugated goat anti-human kappa light chain antibody (Bethil). The sample was detected with TMB Microwell Peroxidase Substrate System (KPL). A standard curve was generated using Human Reference Serum (Lot 3, Bethil) or IgG/Purified Human Sheath (Bethil).
[00181]For the detection of IgG binding to gp120, ELISA plates were coated with 0.04 to 0.10 µg per well of HIV-1 gp120MN protein (Protein Sciences) for 1 hour. Plates were blocked with 1% BSA (KPL) in TBS for at least 2 hours. Samples were incubated for 1 hour at room temperature in TBST containing 1% BSA (KPL), then incubated for 30 minutes with HRP-conjugated goat anti-human IgG-Fc antibody (Bethil). The sample was detected with TMB Microwell Peroxidase Substrate System (KPL). A standard curve was generated using purified b12 or VRC01 protein, as appropriate for the samples. HIV virus production and titration
[00182] 293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mixture (Mediatech), 1% glutamine (Mediatech) in a 5% CO2 incubator at 37°C . Three days before transfection, two 15 cm dishes were seeded with 3.75 x 106 cells each in 25 ml of medium. Two hours before transfection, the medium was changed to 15 ml of new medium. Forty micrograms of plasmid36 pNL4-3 encoding an infectious molecular HIV clone were transfected using Trans-IT reagent (Mirus) according to the manufacturer's instructions. Supernatant collections were performed at 24, 48 and 72 hours after transfection and 15 ml of fresh medium was gently added to the plate after each collection. Pooled supernatants were filtered using a 0.45 µm filter to remove cell debris and aliquoted for storage at -80°C. HIV was quantified following the manufacturer's instructions using an Alliance HIV-1 p24 antigen ELISA kit (Perkin-Elmer). In vitro HIV protection assay
In vitro neutralization assays on luciferase reporter cells were performed according to the typical procedure described as follows. TZM-bl cells from the National Institutes of Health AIDS Research and Reference Reagent Program were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mixture (Mediatech), 1% glutamine (Mediatech) in a 5% CO2 incubator at 37°C. Before the assays, TZM-bl cells were trypsinized, counted and resuspended at a concentration of 105 cells per milliliter, in a total volume of 15 ml. Cells were mixed with 75 μg ml-1 DEAE-dextran and varying concentrations of each antibody as indicated and allowed to incubate on ice during virus preparation. To prepare virus dilutions, NL4-3 stock was diluted to 250 ng ml-1 in growth medium and subsequently serially diluted four times in the assay plate. One hundred microliters of medium containing 10,000 cells preincubated with antibody were added to wells containing previously diluted virus. Infection was allowed to proceed for 48 hours in a 5% CO2 incubator at 37°C. Prior to plate reading, 100 ml of BriteLite reagent (Perkin Elmer) was added to each well, and the plate was incubated for 2 minutes at room temperature. One hundred and twenty microliters from each well were then transferred to an opaque plate and read by VICTOR3 (Wallac 1420 VICTOR3 plate reader, PerkinElmer). Production of humanized mice for in vivo challenge
[00184] Humanized mice were produced essentially according to the procedure described as follows. Human peripheral blood mononuclear cells (AllCells) were thawed from -80°C, expanded in RPMI medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mixture (Mediatech), 1% glutamine (Mediatech) , 50 μM β-mercaptoethanol, 10 mM HEPES(Gibco), 13 non-essential amino acids (Gibco), 13 sodium pyruvate (Gibco) and stimulated for T cell expansion with 5 μg ml-1 phytohemagglutinin (Sigma) and 10 ng ml-1 of human IL-2 (Peprotech) in a 5% CO2 incubator at 37°C. Cells were expanded for 7 to 13 days prior to use. For engraftment, 2 million to 4 million cells were injected intraperitoneally into NSG mice in a volume of 300 ml of medium. HIV protection experiments
[00185] One day before HIV challenge, blood samples from each mouse were subjected to ELISA for antibody quantification and flow cytometry to determine reference CD4/CD8 ratios. The next day, mice were challenged by intraperitoneal or intravenous injection of 100 µl containing the specified dose of HIV diluted in PBS. Infected mice underwent weekly blood sampling to determine the ratio of CD4 to CD8 cells in the T lymphocyte subset by flow cytometry. flow cytometry
[00186] Blood samples were taken from mice by retro-orbital bleeding and were centrifuged for 5 minutes at 1,150 g in a microfuge to separate plasma from cell pellets. Plasma was removed and frozen for further analysis and cell pellets were resuspended in 1.1 ml of 1 x RBC lysis buffer (Biolegend) and incubated on ice for at least 10 minutes to remove red blood cells. After lysis, samples were pelleted at 1,150g in a microcentrifuge for 5 minutes at room temperature, and pigmented with 65 μl of a cocktail containing 5 μl of anti-human CD3-FITC antibodies, 5 μl of anti-human CD4-PE , 5 μl of anti-human CD8a-APC (Biolegend) and 50 μl of phosphate-buffered saline supplemented with 2% fetal bovine serum (PBS1). The samples were washed with 1 ml of PBS+ and again pelleted at 1,150g in a microcentrifuge for 5 minutes. The pelleted cells were resuspended in 200 μl of PBS+ supplemented with 2 μg ml-1 of propidium iodide (Invitrogen) and analyzed in a FACSCalibur flow cytometer (Beckton-Dickinson). The samples were first activated by CD3 expression before determining the ratio of CD4 cells to CD8 within this subset. Samples containing less than 20 CD3+ events were excluded from the analysis. Histological pigmentation for HIV p24
[00187] At the conclusion of the in vivo challenge experiments, spleens were removed from the mice and immersed in 10% neutral buffered formalin for 24 hours. After fixation, tissues were removed and placed in 70% ethanol until embedded and processed standard paraffin. Sections (4 mm thick) were then taken and immunohistochemical pigmentation was performed for the detection of HIV-p24 using the murine monoclonal antibody Kal-1 and standard antigen retrieval techniques. Slides were examined by a pathologist (D.S.R.) on an Olympus BX51 microscope and images obtained using a SPOT Insight Digital Camera (Diagnostic Instruments). Example
1 Construction and Cloning of Modular AAV Transfer Vectors
[00188]To construct the AAV transfer vectors, the oligonucleotides encoding the 145 base pair (bp) AAV2-derived inverted terminal repeat 1 (ITR1) in 'flip' orientation and ITR2 in 'flop' orientation flanked by sites restriction enzymes were synthesized (Integrated DNA Technologies) and annealed before ligating into plasmid vector PBR322. Subsequently, promoters, transgenes and polyadenylation signals flanked through compatible sites were amplified by PCR and cloned between the ITRs, resulting in a modular AAV transfer vector, in which unique combinations of restriction sites flanked each element.
[00189]To assess the potential expression of various promoters in muscle expression, a series of vectors carrying the luciferase gene driven by a panel of ubiquitous and tissue-specific promoters was prepared. These vectors were administered intramuscularly via a single injection into the gastrocnemius muscle and luciferase expression was monitored to determine the relative potential expression of each promoter in this target tissue. The immediate early promoter of cytomegalovirus (CMV), chimeric chicken β-actin (CAG), and ubiquitin C (UBC) promoters provided strong muscle expression (Fig. 1A).
[00190] A novel synthetic CASI promoter (about 1.05 kb in length) (Fig. 1B) was generated. The CASI promoter consists of the cytomegalovirus (CMV) immediate early promoter followed by a chicken β-actin (CAG) promoter fragment containing the transcription initiation site. This fusion is immediately followed by a synthetically designed intron that utilizes splice donor and splice acceptor consensus sequences flanking the enhancer region of the human ubiquitin C (UBC) promoters. The in vivo test demonstrated that the CASI promoter was considerably more active in muscle than the CAG promoter despite being 34% more compact (Fig. 1C). The woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was then incorporated into the AAV transfer vector, which significantly enhanced transgene expression (Fig. 1D).
[00191] The efficiencies of various polyadenylation signals have also been examined for muscle-derived expression. SV40 late poly(A), rabbit beta-globin (RBG) poly(A), and bovine growth hormone (BGH) poly(A) demonstrated comparable levels of expression (Fig. 1D).
[00192] Fig. 1E shows a schematic illustration of a portion of the optimized muscle expression vector encoding an IgG1 scaffold into which the heavy and light chain V regions derived from monoclonal antibodies can be inserted.
[00193] Fig. 2 shows a schematic map presentation of an optimized muscle expression vector with an inserted luciferase transgene. As shown in Supplemental Figure 2, the vector has unique restriction sites flanking each modular element (eg, XhoI, SpeI, NotI, BamHI, Acc65I, HindIII, and NheI). In this vector, the AAV sequences start immediately after the XhoI restriction site with a 145bp flip terminal inverted repeat (ITR) of AAV2 followed by a SpeI restriction site and the CASI promoter. The CASI promoter is followed by a NotI restriction site and an additional C residue after the consensus identification sequence of the GCGGCCGC cleavage site (SEQ ID NO: 35) to mimic a Kozak consensus sequence before the ATG of the luciferase transgene . The 3' end of the transgene is completed with a TAA stop codon followed by an additional A residue before the BamHI site. The WPRE element follows this restriction site and continues until an Acc65I restriction site that precedes an SV40 late polyadenylation signal and HindIII restriction site. In addition, a second 145bp AAV2 “flop” ITR is located before an NheI site. Example
two Production and purification of recombinant AAV viruses
[00194] Recombinant AAV virus was produced and purified from culture supernatants according to the procedure as described in the following.
[00195] 293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mixture (Mediatech) and 1% glutamine (Mediatech) in a 5% CO2 incubator at 37° Ç. Three days before transfection, four 15 cm dishes were seeded with 3.75 x 106 cells each in 25 ml media. Alternatively, 1.875 x 106 cells can be plated per dish four days prior to the day of transfection (7.5 x 106 cells plated by virus). Two hours before transfection, media was changed to 15 ml of new media.
The AAV transfer vector was co-transfected with adenoviral helper vectors (pHELP (Applied Viromics) or pAd-delta-F6) and helper plasmid expressing the AAV Rep and Cap gene products (pAAV 2/8 SEED) at a ratio of 0.25:1:2 using BioT transfection reagent (Bioland Scientific). The total amount of DNA used per transfection was 80 µg. Five AAV virus collections were performed at 36, 48, 72, 96 and 120 hours after transfection. For each time point, media was filtered through a 0.2 µm filter and 15 ml of fresh media was gently added to the plate.
[00197] After collection, approximately 75 ml of 5 x PEG solution (40% polyethylene glycol, 2.5M NaCl) was added to the total volume of collected supernatant (~ 300 ml) and the virus was precipitated on ice for at least 2 hours. The precipitated virus was pelleted at 7.277g for 30 minutes (Sorvall RC 3B Plus, rotor H-6000A) and resuspended in 1.37g ml-1 cesium chloride. The resuspended virus was uniformly divided into two Quick-Selar tubes (Beckman) and rotated at 329,738g at 20°C for 24 hours (Beckman Coulter, Optima LE-80K, 70Ti rotor). The 100 to 200 ml fractions were collected in a 96-well flat-bottomed tissue culture plate, and a refractomer was used to quantify the refractive index of 5 ml of each fraction. The wells exhibited refractive indexes between 1.3755 and 1.3655, and were combined and diluted to a final volume of 15 ml using Test Formulation Buffer 2 (TFB2, 100 mM sodium citrate, 10 mM Tris, pH 8). Virus was loaded onto MWCO 100 kDa centrifuge filters (Millipore) and subjected to centrifugation at 500 g at 4°C until 1 ml of retentate remained. The retained virus was then further diluted to a total volume of 15 ml in TFB2 and this process was repeated such that the virus was washed three times. The final volume of retentate was between 500 to 1000 ml total, which was fractionated and stored at -80°C. Example
3 Antibody transgene optimization
[00198] To create an ideal framework for antibody expression, the heavy and light chains of several broadly neutralizing HIV antibodies separated by a high-splicing F2A peptide sequence were cloned into a mammalian expression vector under the control of the CMV promoter. 293T cells transfected with these vectors demonstrated secretion of human IgG in the culture supernatant which could be detected by ELISA (Fig. 3A). To improve expression, the F2A sequence was re-engineered to better reflect mammalian codon usage and incorporated an N-terminal furin cleavage site for optimal processing. Comparison of vectors with optimized F2A sequence (SEQ ID NO: 9) to vector with standard F2A sequence (SEQ ID NO: 10) through transfection showed that vectors with optimized F2A sequence produced higher levels of all four antibodies tested.
[00199] To improve antibody secretion, the endogenous signal sequences were replaced with a codon optimized sequence derived from human growth hormone (HGH) and created versions of the 4E10 expression vector, in which the heavy chain, the light chain , or both strands were driven through separate HGH signal sequences and compared their expression by transfection. To minimize repetitive sequences in vectors, two HGH sequences (SEQ ID NOs: 11 and 12) were synthesized, which had distinct nucleotide sequences but encoded identical amino acids, and each was used for the heavy or light chain exclusively. Replacing the endogenous signal sequences with HGH sequences in the heavy or light chains resulted in higher levels of antibody production, and replacing the signal sequence from both chains produced the best result (Fig. 3B).
[00200]To remove the potential for the improper splice from the transcription encoding the antibody, the sequence was subjected to silico splice prediction and removed all potential splice donor and acceptor sequences through the use of site-conservative mutations or, when this was not possible, the adjacent sequences. Improved expression of the 4E10 antibody was observed when placed in this splice-optimized structure (Fig. 3C).
A schematic illustration of the structure of the final antibody transgene is shown in Fig. 3D. As shown in Fig. 3D, the antibody transgene consists of an HGH signal sequence followed by an exchangeable VH region, a splice-optimized heavy chain constant region, a furin cleavage site linked to an optimized F2A peptide that is fused to a second HGH signal sequence, an exchangeable VL region, and a splice-optimized kappa light chain constant region.
[00202] To confirm that the above-described optimizations made to improve gene expression do not affect the effectiveness of neutralizing antibodies, several well-studied broadly neutralizing antibodies (eg anti-HIV antibodies to b12, 2G12, 4E10 and 2F5) were optimized expression vector expressions. The antibodies produced were purified and tested in an in vitro protection assay using TZM-bl luciferase reporter cells. Cells carrying a luciferase gene under the control of HIV-induced transcriptional elements (TZM-bl cells) were incubated with dilutions of each antibody prior to inoculation with increasing amounts of HIV. Cells were plated with various concentrations of the antibodies prior to inoculation with rising titers of the NL4-3 HIV strain. Two days after inoculation, cells were lysed and quantified for luciferase activity following the addition of luciferin substrate. The strong reduction in TZM-bl cell infection was observed at antibody concentrations that correlated well with the previously established IC50 and IC90 values for all four antibodies tested against this strain (Fig. 4A-D). Example
4 In vivo expression of antibody transgene
Recombinant AAV viruses with capsid serotype 8 expressing luciferase or HIV neutralizing antibody 4E10 driven from cytomegalovirus (CMV) promoters were administered to mice via a unitary injection of the gastrocnemius muscle. Xenogen images of a representative Rag2tyc mouse 15 weeks after intramuscular injection of 1x1010 of AAV2/8 expressing luciferase genome copies are shown in (Fig. 5A). Within one week of administration, the expression of the luciferase gene or antibody was detectable (Figs. 5B and 5C, respectively). Expression continued to rise, reaching maximum levels after 12 to 16 weeks and then decreasing two to three times before leveling off for the duration of the 64-week study. Figures 5B-C show that antibody production is dose-dependent and is maintained for at least 64 weeks.
[00204] The heavy and light chain variable regions of the HIV neutralizing antibody b12 were cloned into the AAV transfer vector, and recombinant AAV stock was produced for intramuscular administration of 1x1011 genome copies in the gastrocnemius muscle of mouse strains (two immunodeficient and two immunocompetent: NOD/SCID/yc (NSG), Rag2/yc (RAG), C57BL/6 (B6) and Balb/C. The mice produced the encoded antibody at serum concentrations that were 100 times higher than the levels obtained with the unoptimized vector, and this level of expression persisted for at least 52 weeks (Fig. 6 compared to Figs. 5C). Very limited mouse antibodies were elevated against human b12-IgG in B6 mice, whereas Balb/C animals generated detectable mouse antibodies against the transgene that does not appear to affect human IgG levels. Example
5 Prevention of CD4 cell loss caused by HIV inoculation
Humanized HuPBMC-NSG mice show CD4 cell depletion after inoculation with replication competent HIV (20 ng p24 NL4-3, n = 4, Fig. 7). This mouse model was used to test the ability of the vectors described in this report to protect mice from inoculation in vivo.
Recombinant AAV viruses expressing luciferase or b12 antibody were administered into NSG mice, producing stable serum b12 antibody concentrations of approximately 100 µg ml-1 within 6 weeks (Fig. 8A). These mice were adoptively populated with expanded human peripheral blood mononuclear cells (huPBMCs), engrafted over a period of 2 weeks. The mice were then inoculated by intraperitoneal injection of the NL4-3 strain of HIV.
[00207] After HIV inoculation, most mice expressing luciferase showed dramatic loss of CD4 cells whereas mice expressing b12 antibody showed no CD4 cell depletion (Fig. 8B).
[00208] This example demonstrates that recombinant AAV virus expressing an anti-HIV antibody can protect mice from CD4 cell loss caused by HIV infection. Example
6 Protection Using Various HIV Neutralizing Antibodies
[00209]To compare the protective abilities of various broadly neutralizing HIV antibodies, recombinant AAV viruses expressing b12, 2G12, 4E10 and 2F5 were produced and administered in NSG mice, respectively. Seven weeks after administration, NSG mice produced 20 to 250 μg ml-1 of the indicated antibodies (Fig. 9A). The in vivo serum concentrations of each of the HIV antibodies were measured. The results are shown in (Fig. 3A).
Transduced mice were adoptively populated with huPBMCs, inoculated by intravenous injection with HIV, and tested weekly to quantify CD4 cell depletion over time (Fig. 9B). As shown in Fig 9B, animals expressing b12 were completely protected from infection, and those expressing 2G12, 4E10 and 2F5 were partially protected. The groups demonstrated partial protection consisting of animals with delayed CD4 cell depletion as well as animals that maintained high CD4 cell levels throughout the course of the experiment.
Eight weeks after inoculation, mice were sacrificed and paraffin-embedded spleen sections underwent immunohistochemical staining for HIV-expressed p24 antigen to quantify the extent of infection (Fig. 9C). As shown in Fig. 9D, mice expressing b12 had no detectable p24 expressing cells. Example
7 Determination of robustness of anti-HIV protection
[00212] A large group of mice expressing b12 antibody was adoptively populated with huPBMCs. Before inoculation, all mice expressed high levels of human IgG, presumably due to the engrafted human B cells (Fig. 10A), but only those that received the specific IgG produced by the vector expressing b12 to gp120, which reached 100 μg ml- 1 (Fig. 10B).
Uninfected mice expressing luciferase or b12 demonstrated compatible high-level CD4 cell engraftment throughout the course of the experiment, showing that transgene toxicity did not contribute to CD4 cell loss (Fig. 11). In contrast, mice expressing luciferase that received 1 ng of HIV experienced rapid and extensive CD4 cell depletion. At higher doses, infection in mice expressing luciferase becomes more compatible and resulted in depletion of CD4 cells below the detection level in some cases (25, 125 ng doses). Notably, all mice expressing b12 demonstrated protection from CD4 cell loss, despite receiving doses of HIV 100 times higher than needed to deplete seven of the eight control animals (Fig. 11).
[00214] This example shows that the recombinant AAV virus, disclosed in this report, can be used to provide effective and robust immunoprophylaxis against HIV infection. Example
8 b12 anti-HIV antibody expression
Fig. 12A is a batch showing expression of b12 over time as a dose function as determined by ELISA of total human IgG in serum samples taken after AAV administration (n = 8). Mice that received vector expressing luciferase exhibited no detectable human antibody (n = 12). Fig. 12B shows serum b12 concentration one day before inoculation, 3 weeks after adoptive transfer of human PBMCs, and 15 weeks after intramuscular administration of the indicated dose of AAV as determined by a gp120-specific ELISA to measure the fraction of antibodies capable of binding to HIV (n = 8 - 12). Fig. 12C shows CD4 cell depletion in humanized HuPBMC-NSG mice as a result of intravenous inoculation with 10 ng of NL4-3 in animals expressing a b12 band demonstrating the minimum dose of antibody needed to protect against infection. Figs 12A and C show mean and standard error, lot b shows individual animals and mean (n = 8 - 12). Example
9 Comparison of b12 and VRC01 antibodies in anti-HIV protection
In these examples, b12 antibody was compared to VRC01 antibody, an anti-HIV antibody neutralized in 90% of circulating HIV strains in vitro. Decreasing doses of vector expressing b12 or VRC01 were administered to NSG mice, and antibody expression over time was monitored.
[00217]For both antibodies, dose-dependent expression was observed at all time points analyzed (Fig. 12A and Fig. 13A). Mice expressing luciferase or antibodies at various levels were adoptively populated with huPBMCs. Just prior to inoculation, a gp120-specific enzyme-linked immunosorbent assay (ELISA) confirmed the effective antibody concentration in each group (Fig. 12B and Fig. 13B). After intravenous inoculation with 10 ng HIV, CD4 cells were monitored to determine the impact of antibody concentration. A mean b12 concentration of 34 μg ml-1 and VRC01 concentration of 8.3 μg ml-1 protected mice from infection (Fig. 12C and Fig. 13C). Groups expressing lower concentrations of b12 and VRC01 were partially protected, with several animals showing no detectable CD4 cell loss and others exhibiting delayed CD4 cell depletion. Example 10 Flu Infection Protection
[00218] In this example, the AAV vector disclosed in this report was used to produce recombinant AAV viruses that express anti-influenza antibodies, and the recombinant AAV viruses were effective in protecting mice from influenza virus infection. Experimental materials and methods Influenza virus production and quantification
[00219] All influenza viruses used for infections in mice in this example have derived their six internal genes (PB2, PB1, PA, NP, M, and NS) from the A/Puerto Rico/8/1934 (H1N1) strain. The HA and NA genes were derived from the following three strains and provided the following name abbreviations: (1) PR8: HA and NA were derived from A/Puerto Rico/8/1934 (H1N1), a widely used laboratory adapted strain. (2) CA/09: HA and NA were derived from A/California/07/2009 (H1N1), a strain isolated early during emergence in humans of the 2009 pandemic H1N1 disease of swine origin. (3) SI/06 : HA and NA were derived from A/Solomon Islands/3/2006 (H1N1), a human seasonal H1N1 vaccine strain.
[00220] Influenza viruses were generated using the 8-plasmid reverse bidirectional genetic system. Briefly, 293T and MDCK cells were maintained in DMEM (Mediatech) supplemented with 10% fetal bovine serum (Omega Scientific), 100 IU/ml penicillin (Mediatech), 100 μg/ml streptomycin (Mediatech), and 1% L-Glutamine (Mediatech). Tissue culture plates from 6 wells (Corning) containing co-cultures of 293T and MDCK cells were co-transfected with 250 ng of each of the 8 plasmids. At 14 hours after transfection, media was aspirated, cells were washed once with PBS, and influenza growth medium plus 3 µg/ml TPCK-treated trypsin (Sigma-Aldrich) were added to the cells. Influenza growth medium consists of Opti-MEM I (Invitrogen) with 0.01% fetal bovine serum, 0.3% bovine serum albumin (Invitrogen), 100 IU/ml penicillin, 100 μg/ml streptomycin , and 100 µg/ml of calcium chloride. After 72 hours, the supernatant was collected and passed to 15 cm plates (Corning) containing nearly confluent MDCK cells in influenza growth medium plus 3 µg/ml trypsin. After 72 hours, the viral supernatant was collected and centrifuged at 2000xg for 5 minutes. Viral supernatant was removed and aliquoted, and aliquots were frozen at -80°C. Platelet Assays
[00221] Influenza viruses were quantified by platelet assays on MDCK cells using an Avicel microcrystalline cellulose coating. Briefly, MDCK cells were seeded in 6-well tissue culture plates. When cells were 95% confluent, media was removed and 10-fold serial dilutions of viral inoculum were added to a final volume of 1 ml of influenza growth medium. After 40 minutes, the inoculum was removed by aspiration and replaced with 4 ml of influenza growth media with 2.4% Avicel microcrystalline cellulose and 3 µg/ml TPCK-treated trypsin. Plates were grown unchanged for 3 days at 37°C. The coating was then removed by aspiration, the cell layer was washed twice with PBS, and the cells were stained with 0.1% crystal violet in 20% ethanol for 15 minutes. The staining solution was then removed by aspiration, the cells were washed again with PBS, and the platelets were counted visually to determine the viral titer in terms of platelet-forming units (PFU). strains of mice
BALB/cJ immunocompetent (BALB/c) and NOD/SCID/Y-/-(NSG) immunodeficient mice approximately 4 to 5 weeks of age were obtained from Jackson Laboratory (JAX). For experiments involving old mice, these animals were bred and housed under barrier conditions for the period of time before influenza inoculation. Cloning of Neutralizing Influenza Antibodies into AAV Vector
[00223] Sequences corresponding to the heavy and light chain variable regions of various influenza antibodies were synthesized (Integrated DNA Technologies) and cloned into an AAV transfer vector containing the IgG1 constant region structure. In some examples, the antibody gene has been optimized to improve antibody production in vivo. Production and administration of AAV to mice
[00224] The production and intramuscular injection of AAV were performed according to the procedure described as follows. Briefly, 1.2 x 108 293T cells were transfected with 80 µg of the vector encoding the antibody of interest, pHELP (Applied Viromics), and pAAV 2/8 SEED (University of Pennsylvania Vector Core) at a ratio of 0.25:1 :two. The supernatant was collected 5 times during the 120 hour course. Virus was purified by PEG precipitation and cesium chloride fractionation before being diafiltered, concentrated, and buffer exchanged through 100k MWCO centrifuge filters (Millipore) into buffer consisting of 100 mM sodium citrate and 10 mM sodium citrate Tris at pH 8 before aliquoting and storing at -80°C. To quantify aliquots, virus was thawed, treated with DNAse, and titrated by qPCR as previously described (13). Briefly, viral titer was determined by quantitative PCR using a standard curve generated from previously titrated purified AAV2/8 encoding the 4E10 antibody. The infectivity of virus aliquots was confirmed in vitro by transduction of 293T cells and quantification of antibody concentration in cell supernatant by ELISA. Mouse AAV transduction and quantification of gene expression
[00225] Before intramuscular injection, recombinant AAV viruses were thawed and diluted to the indicated dose with buffer (100 mM sodium citrate, 10 mM Tris at pH 8) in a volume of 40 μL. The mice were anesthetized by isoflurane inhalation, and the viruses were administered as a 40 µL unit injection into the gastrocnemius muscle.
Bioluminescent imaging was performed using an IVIS 200 instrument essentially as previously described with the following modifications: Bioluminescent images were taken 10 minutes after intraperitoneal injection of 1.5 mg D-luciferin (Gold Biotechnology). The concentration of human IgG in mouse serum was determined by performing ELISAs using a standard curve generated from purified IgG/Human Kappa (Bethil). Inoculation of mice with flu
[00227] Influenza viruses were thawed and diluted in PBS to release the indicated dose in a volume of 20 μL. Before inoculation, mice were weighed and anesthetized by intraperitoneal injection of 200 μL of a cocktail containing 2 mg of ketamine and 0.2 mg of xylazine diluted in PBS. Mice were inoculated with influenza by intranasal inoculation with 20 μL of diluted virus, 10 μL per nostril. Infected mice were weighed at the same time each day. Production and quantification of the GFP influenza virus
PB1flank-GFP influenza viruses were generated in which GFP is packaged into the PB1 segment according to the methods described in Bloom et al. Science 328:1272 (2010). PB1flank-GFP viruses were cultured and evaluated in 293T-CMV-PB1 and MDCK-SIAT1-CMV-PB1 cells that provided the PB1 protein absent in trans, as described in Bloom et al. PB1flank-GFP viruses were generated using the 8-plasmid bidirectional reverse genetic system, but with the standard PB1 plasmid replaced by pHH-PB1flank-eGFP. For these viruses, the other five internal genes (PB2, PA, NP, M, and NS) were derived from the PR8 strain as for the viruses used in mouse infections. In addition to viruses with the HA and NA of PR8, CA/09, and SI/06, two additional viruses were used in these assays: (1) JP/57: HA and NA were derived from A/Japan/305/1957 (H2N2 ), an early strain of pandemic Asian flu disease. (2) Viet/04: the HA of A/Vietnam/1203/2004 (H5N1), a highly pathogenic avian influenza strain. The NA for this virus was derived from the A/WSN/1933 (H1N1) strain adapted in the laboratory. The polybasic cleavage site was removed from the HA.
[00229] PB1flank-GFP viruses were quantified by flow cytometry. MDCK-SIAT1-CMV-PB1 cells were seeded in 12-well plates (Corning) at 105 cells per well in 1 ml of influenza growth medium. 8 hours after seeding, viruses were diluted 1:10, 1:100, and 1:1000 in the media. Reservoirs were infected with 50 μL of each of these dilutions. Cells were harvested 16.5 h after infection by incubation with 250 μL of trypsin-EDTA (Invitrogen) for five minutes, removal of trypsin by aspiration, and resuspension in 250 μL of PBS supplemented with 2% fetal bovine serum and 2 μg/ml of propidium iodide (Invitrogen). Samples were analyzed on a FACSCalibur flow cytometer (Beckton-Dickinson), and samples with a percentage of GFP-positive cells between 0.3 and 3% were used to quantify viral titer. Titer was calculated from the percentage of GFP-positive cells, the dilution factor, and the total count of 105 cells per well. Neutralization tests
[00230] Neutralization assays were performed using influenza virus PB1flank-GFP and MDCK-SIAT1-CMV-PB1 cells. 40 μL of influenza growth medium was added to all wells of a 96-well flat-bottomed tissue culture plate (Corning), except for Row A, which received 57 μL of media. Mouse serum samples were serially diluted by adding 3 μL of serum to the 57 μL of influenza growth medium in Row A, then performing 1:3 serial dilutions up to Row G, resulting in an initial dilution of 1:20 and final dilution 1: 4.374 x 104.2 2 x 104 infectious particles of PB1flank-GFP virus (as determined by titration by flow cytometry) were added to the samples in a volume of 20 µL of influenza growth medium. The diluted serum and virus mixtures were incubated for 1 h in a 5% CO2 incubator at 37°C. After incubation, 2x104 MDCK-SIAT1-CMV-PB1 cells in a 20 μL volume of influenza growth medium were added to all wells for an MOI of 1. A single cell control, which received BALB/ mouse serum naive c and no virus, and a virus control, which received serum from a naive BALB/c mouse, were included for each virus. Plates were incubated in a 5% CO2 incubator at 37°C for 18 hours. After incubation, 40 μL of 1.5% Triton X-100 (Sigma-Aldrich) in PBS was added to each well to provide a final concentration of 0.5% Triton X-100, and plates were incubated at temperature environment for 5 minutes. 100 μL of each sample was transferred into 96 opaque well plates (Corning) for reading. GFP fluorescence was quantified using a Safire2 plate reader (Tecan) configured to read from the top with 485 nm excitation, 515 nm emission, 12 nm slit widths for both excitation and emission, gain adjusted to "ideal, ” an integration time of 500 μs, and 5 readings per reservoir. The background fluorescence of the single cell control was subtracted from all readings. Samples were normalized for viral control. Histology
[00231]At the conclusion of the in vivo inoculation experiments, the lungs were removed from mice and half of this tissue was immersed in 10% neutral buffered formalin for 24 hours. Following fixation, tissues were removed from formalin and placed in 70% ethanol until embedding in standard paraffin and processing. Four micron thick sections were then taken, and staining with hematoxylin and eosin (H&E) was performed. The slides were examined by a pathologist (D.S.R.) on an Olympus BX51 optical microscope, and images were obtained using a SPOT Perception Digital Camera (Diagnostic Instruments). Inflammation was recorded as follows: 0 = no inflammation to minimal inflammation; 1 = occasional infiltrates in the bronchioles (less than 10% bronchioles); 2 = easily identified infiltrates in the bronchioles (10 to 50% of bronchioles); 3 = easily identified infiltrates in the bronchioles with parenchymal infiltrates and/or initially irregular fibrosis; 4 = > 50% bronchioles with infiltrates, OR 10 to 50% bronchiole involvement with extensive necrotic epithelium in the bronchioles, angionecrosis, or extensive fibrosis. Counting was done in a blind fashion and an ordinal scale was considered for any statistical tests. Relative viral quantification by RT-qPCR
[00232]Lung tissue was homogenized in 100 μL of PBS. 25 μL of homogenate was used for RNA extraction through TRIzol Reagent (Invitrogen). The purified RNA was resuspended in nuclease-free water, and the RNA concentration was normalized to 150 ng/μL. Real-time RT-qPCR was performed using single-step SYBR Green qScript qRT-PCR Kit, Rox (Quanta Biosciences) with primers designed against PR8 M and an endogenous control consisting of mouse ribosomal protein L32. M Forward: CAAGCAGCAGAGGCCATGGA (SEQ ID NO:36), M Reverse GACCAGCACTGGAGCTAGGA (SEQ ID NO:37), L32 Forward AAGCGAAACTGGCGGAAAC (SEQ ID NO:38), L32 Reverse TAACCGATGTTGGGCATCAG (SEQ ID NO:39). Samples were treated with DNAse using the Turbo DNAse Kit (Invitrogen) and run in triplicate on an ABI 7300 Real Time PCR System (Life Technologies) with the following program: 50°C for 10 minutes, 95°C for 5 minutes, 40 cycles of 95°C for 15 seconds and 55°C for 30 seconds, followed by a melting curve analysis. Each sample was individually normalized by L32 signal to account for the variation in input RNA. Anti-influenza antibody expression in vivo
Recombinant AAV viruses expressing unmodified full-length anti-influenza F10 or CR6261 antibody have been produced. A single intramuscular injection of 1x1011 genome copies (GC) of the recombinant AAV virus was administered into the gastrocnemius muscle of Balb/c mice. Serum samples were obtained weekly and human IgG was quantified by ELISA (Fig. 14). Significant expression of b12 antibody above 100 μg/mL was observed. In contrast, both F10 and CR6261 antibodies demonstrated approximately 1 μg/mL of expression in one week that became undetectable at the next time point before slowly escalating to several micrograms per mL of serum by week 7.
To improve in vivo expression of F10 and CR6251 antibodies, chimeric antibody constructs in which the light chains of each of F10 and CR6251 antibodies were replaced with the light chain of b12. Following transfection of 293T cells, substantially higher expression of both antibodies was observed when paired with b12 light chains, indicating that the non-native light chain improved antibody expression (Fig. 15A). To improve the expression of natural light chains, a set of modified light chain variable regions containing 5' and 3' junctional sequences derived from the light chains of b12 or 4E10 antibodies was created. The modified light chain variable regions used are listed in Fig. 15B. Following transfection of 293T cells, the F10LO24 light chain containing sequences from b12 as well as 4E10 exhibited as much as 12-fold higher in vitro expression (Fig. 15C]). Likewise, transfection of CR6261LO13 light chain containing constructs with b12 antibody sequences exhibited as much as 20-fold higher in vitro expression (Fig. 15D). These modified antibodies were tested using in vitro neutralization assays, and the results confirmed that the antibodies containing modified light chains maintained their ability to neutralize two strains of influenza. In light of the substantially improved antibody expression observed for modified light chains, all subsequent experiments were performed with the modified sequences F10LO24 and CR6261LO13 and referred to as F10 and CR6261 respectively. The complete variable region sequences used, including the chimeric light chain variable regions, are provided in SEQ ID NOs: 40 to 43.
[00235] As shown in Fig. 16A, a single intramuscular injection of 1x1011 genome (GC) copies of AAV into BALB/c mice produced detectable antibody within one week of injection. Antibody concentrations transiently decreased before increasing over the next 6 to 8 weeks, reaching a plateau between 50 and 200 μg/mL that was maintained for the duration of the 40-week study. In vitro neutralization assays
[00236]To determine the extent of neutralization potential of sera from animals treated with the recombinant AAV viruses, in vitro neutralization assays were performed using GFP reporter influenza virions containing five diverse hemagglutinins of three different HA subtypes (H1, H2 , and H5). As shown in Fig. 16B, sera from mice expressing a negative control antibody (b12, an antibody against HIV) did not demonstrate any appreciable neutralization of any of the five strains tested. In contrast, sera from animals receiving recombinant AAV viruses expressing F10 or CR6261 showed significant ability to neutralize all five strains. in vivo protection
[00237]To determine the ability of the recombinant AAV viruses to protect mice from influenza infection, the recombinant viruses were administered to the animals and allowed five weeks for antibody expression. Just before influenza inoculation, approximately 100 to 200 μg/mL of both b12 and F10 antibodies and a wide range of CR6261 concentrations ranging from 0.1 μg/mL to 100 μg/mL were observed in the mouse circulation (Fig. 17A). Following intranasal administration of the CA/09 strain, dramatic weight loss was observed in animals expressing the control b12 antibody, but no appreciable loss in mice expressing the F10 antibody (Fig. 17B). Mice expressing CR6261 demonstrated a weight loss range that was inversely proportional to the serum IgG concentration, suggesting that a minimum serum concentration of approximately 7.5 μg/mL of this antibody was required to prevent disease from CA/09 infection.
[00238]To examine the ability of VIP to protect against other strains in vivo, animals expressing b12 or F10 control antibody were inoculated with the SI/06 strain (Fig. 17C). Mice expressing the control antibody exhibited weight loss over a two-week period. In contrast, F10 expressing mice showed no signs of disease following inoculation with SI/06.
[00239]To determine the ability of VIP to protect animals from a lethal influenza inoculation, 1000 PFU of the mouse lethal PR/8 strain were intranasally administered to the animals. Mice expressing control b12 experienced dramatic weight loss and reached the goal of our study within 4 days (Figs. 17D-E). In contrast, mice expressing F10 showed no significant signs of disease or weight loss, demonstrating that animals treated with the recombinant AAV viruses were protected against at least three different influenza strains.
[00240]To determine the impact of inoculation of CA/09 and SI/06 on the endogenous immune response in mice inoculated with influenza, serum samples from such animals were analyzed using neutralization assays. Sera from previously inoculated mice expressing the control b12 antibody demonstrated strong neutralizing activity against the inoculating strain, but no detectable activity against heterologous strains (Figs. 17F-G). In contrast, mice treated with recombinant AAV viruses expressing F10 or CR6261 continued to demonstrate broad serum neutralizing activity against all strains tested. Also, although serum neutralizing activity against PR8, VN/04 and JP/57 was not differentially affected by CA/09 or SI/06 inoculation, enhanced serum neutralizing activity against the inoculation strain was observed in mice treated with recombinant AAV viruses (Compare Figs. 17F and 17G). These results suggest that the expression of broadly neutralizing antibodies protected against disease, however, still allowed for the formation of additional, even more potent, endogenous humoral immunity.
[00241] This example shows that the recombinant AAV virus disclosed in this report can be used to provide effective immunoprophylaxis against infection caused by various influenza viruses. Example
11 Protection from flu infection in older and immunocompromised animals
[00242] Recombinant AAV viruses expressing the variable regions of the broadly neutralizing influenza antibodies F10 and CR6261 have been produced.
[00243] Immunodeficient NOD/SCID/Y-/-(NSG) mice are mice that completely lack adaptive immunity and exhibit significantly impaired innate immune responses. Recombinant AAV viruses expressing F10 and CR6261 antibodies were administered at a normalized dose of 5x1012 GC per kg to NSG animals that were relatively young (14 to 19 weeks old) or of an advanced age (46 to 55 weeks old). Gene expression was quantified for four weeks using Xenogen imaging or ELISA (Figs. 18A and 18B respectively). Both groups of animals demonstrated remarkably similar levels of gene expression at all time points, suggesting that age did not affect the ability for muscle-based expression of the AAV gene. To determine whether antibody expression in vivo was sufficient to protect these immunocompromised animals from influenza challenge, 1000 PFU of the lethal PR8 strain was administered to both young and old groups of mice (Figs. 18C and 18D respectively).
[00244] In both cases, disease and weight loss were observed in control mice expressing luciferase, which resulted in the death of all such animals during the course of the study. In contrast, both young and old NSG animals expressing F10 were completely protected from influenza-induced weight loss, suggesting that these concentrations of F10 antibody alone were sufficient to protect mice in the absence of an endogenous immune response. To further characterize the extent to which F10 was able to prevent disease in NSG mice, the animals were sacrificed throughout the study period and the level of inflammation was recorded in histological samples of lung tissue. Infected mice expressing luciferase demonstrated substantial luminal infiltration of the bronchioles five days after infection (Fig. 18E left). In contrast, F10-protected animals showed very low levels of inflammation and clear bronchioles consistent with a substantially lower level of pathology in these mice (Fig. 18E right). Counting lung inflammation in histological samples over time demonstrated that animals at early time points exhibited the most severe inflammation (Fig. 18F). Mice expressing F10 antibody exhibited significantly less inflammation at all time points analyzed when compared to luciferase control mice.
[00245]To directly quantify the ability of recombinant AAV viruses to control viral replication, we determined the amount of virus in NSG mice by extracting total RNA from lung tissue collected at the time of sacrifice and viral RNA measured by quantitative RT-PCR . As shown in Fig. 18G, the lungs of mice expressing luciferase exhibited a high viral load throughout the course of the experiment. In contrast, F10 expressing animals analyzed at early time points contained moderate levels of viral RNA that decreased substantially over time as a result of dramatically reduced viral replication in the presence of F10 antibody despite the lack of endogenous adaptive immunity. Example
12 Protection from HIV infection in humanized mice with bone marrow, liver and thymus (BLT)
[00246] The humanized mouse model with bone marrow, liver and thymus (BLT) is a well-established model for the prevention of intravaginal HIV infection. The humanized BLT mouse is produced by surgical implantation of fetal tissues into immunodeficient NOD/SCID/YC (NSG) recipients, followed by grafting of hematopoietic stem cells. These engrafted cells give rise to a complete repertoire of trained immune cells in the mouse that can produce functional immune responses following HIV infection. The BLT method has been found to exhibit significant human cell engraftment from mucosal tissues including vagina and colon and has been shown to support HIV transmission following mucosal exposure to concentrated JR-CSF CCR5-tropic HIV virus. In this example, BLT mice were used to test the ability of recombinant AAV viruses that express anti-HIV antibodies to prevent HIV transmission through mucosal pathways.
[00247] Recombinant AAV viruses expressing anti-HIV antibody VRC01 or luciferase protein were produced according to the methods disclosed in this report. To test the effectiveness of the VRC01 antibody in preventing transmission of HIV to the mucosal surface, a cohort of BLT animals was produced and recombinant AAV viruses expressing VRC01 were administered to BLT mice to generate animals expressing neutralizing antibody VRC01 at a serum concentration of 100 μg/mL or protein luciferase as a negative control.
[00248]To shape the relatively infrequent nature of HIV transmission in human mucosa, a low dose repetitive inoculation regimen of weekly non-abrasive vaginal administrations of unconcentrated JR-CSF HIV virus was adopted. A schematic representation of the HIV inoculation regimen is shown in Figure 19A. Over a 14-week period, mice were bled and then inoculated weekly with 50ng p24 of JR-CSF HIV virus by non-abrasive vaginal inoculum administration. CD4 cell levels were measured weekly using flow cytometry (Figure 19B). As shown in Figure 17B, there was a modest but statistically significant decline in the CD4+ cell level in animals expressing luciferase relative to those producing VRC01. After 13 weeks of repetitive vaginal HIV inoculation, plasma HIV viral loads at the time of sacrifice were measured by the Abbott Real-Time HIV-1 Viral Load qPCR assay (the limit of detection for this assay was 200 copies/mL ). The results are shown in Figure 19C, which revealed that although all animals expressing luciferase became infected, only two of the eight mice expressing VRC01 showed significant evidence of viral replication. These results show that recombinant AAV viruses that express anti-HIV antibodies can prevent mucosal HIV transmission in BLT mice. Example
13 Hepatitis C virus (HCV) antibody production in FVB mice
[00249] This example illustrates that recombinant AAV viruses can be used to produce high level HCV antibody in vivo.
AAV vectors comprising coding sequences for antibodies B12, AR3A and AR3B were constructed. AAV vectors were used to produce recombinant AAV viruses that express B12, AR3A and AR3B antibodies, respectively. Recombinant AAV viruses were administered to FVB mice. Expression Levels corresponding antibody levels in the animal's serum were measured weekly. The results are shown in Figure 20. As shown in Figure 20, significant levels of HCV antibodies were produced in the animal. Example
14 Prevention of HIV infection
[00251]This example illustrates the immunoprophylaxis of a patient at risk for developing HIV infection.
[00252] A recombinant AAV is produced using an AAV transfer vector comprising a polynucleotide encoding a neutralizing anti-HIV antibody. Any known neutralizing anti-HIV antibody can be used, including but not limited to, anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, and any variant thereof. For example, an AAV transfer vector having the CASI promoter, coding sequences for an anti-HIV neutralizing antibody, WPRE sequence and SV40 poly(A) can be used. Examples of such AAV transfer vectors include the vectors provided in SEQ ID NOs: 17 to 21 and 24. A patient is identified as being at risk of developing HIV infection and being administered an effective amount of the recombinant AAV. Recombinant AAV is given to the patient by intramuscular injection. Recombinant AAV expresses the anti-HIV antibody in the patient, thereby reducing the risk for the patient to develop HIV infection. The patient's HIV viral load can be determined at various points in time after the patient is administered recombinant AAV. The appropriate dosage (ie, anti-HIV antibody expression level) and treatment regimen can be readily determined by skilled practitioners based on a number of factors including, but not limited to, the route of administration and the extent of exposure to HIV by the patient. The effectiveness of immunoprophylaxis is evaluated by looking at reducing the risk of HIV infection when compared to patients who do not receive any treatment for AAV. Example
15 Colon Cancer Treatment
[00253]This example illustrates the treatment of a patient suffering from or at risk of developing colon cancer.
A recombinant AAV is produced using an AAV transfer vector comprising a polynucleotide encoding the antibody IMC-C225 (Cetuximab®, an antibody to the epidermal growth factor receptor (EGFR)). For example, IMC-C225 antibody coding sequences can be inserted into an AAV transfer vector having the CASI promoter, WPRE sequence and SV40 poly(A). A patient suffering from or at risk of developing colon cancer is identified and administered an effective amount of recombinant AAV. Recombinant AAV is given to the patient by intramuscular injection. Recombinant AAV expresses the antibody IMC-C225 in the patient, thereby inhibiting cancer progression in the patient. The appropriate dosage (i.e., IMC-C225 antibody expression level) and treatment regimen can be readily determined by skilled practitioners based on a number of factors including, but not limited to, the route of administration and the patient's disease state. . The effectiveness of treatment is assessed by looking at delay or reduction in disease progression, improvement or palliation of the disease state, and remission. Example
16 Prevention of HCV infection
[00255] This example illustrates the immunoprophylaxis of a patient at risk for developing HCV infection.
[00256] A recombinant AAV is produced using an AAV transfer vector comprising a polynucleotide encoding a neutralizing anti-HCV antibody. Any known neutralizing anti-HCV antibody can be used, including but not limited to, anti-HCV AR3A antibody, anti-HCV AR3B antibody, anti-HCV AR4A antibody, and any variant thereof. For example, an AAV transfer vector having the CASI promoter, coding sequences for an anti-HCV neutralizing antibody, WPRE sequence and SV40 poly(A) can be used. Examples of such AAV transfer vectors include the vector given in SEQ ID NO: 22, 23 and 28.
[00257] A patient is identified as being at risk of developing HCV infection and administered an effective amount of the recombinant AAV. Recombinant AAV is given to the patient by intramuscular injection. Recombinant AAV expresses the AR3A antibody in the patient, thereby reducing the risk for the patient to develop HCV infection. The appropriate dosage (ie, anti-HCV antibody expression level) and treatment regimen can be readily determined by skilled practitioners based on a number of factors including, but not limited to, the route of administration and the extent of exposure to HCV. for the patient. The patient's HCV viral load can be determined at various points in time after the patient is administered recombinant AAV. The effectiveness of immunoprophylaxis is evaluated by looking at the reduced risk of HCV infection when compared to patients who do not receive any AAV treatment. Example
17 Prevention of Influenza Virus Infection
[00258]This example illustrates the immunoprophylaxis of a patient at risk for developing influenza virus infection.
[00259] A recombinant AAV is produced using an AAV transfer vector comprising a polynucleotide encoding an anti-influenza neutralizing antibody. Any known anti-influenza neutralizing antibody can be used, including but not limited to, anti-influenza F10 antibody, anti-influenza antibody CR6261, anti-influenza antibody FI6, anti-influenza antibody TCN32, and any variant thereof. For example, an AAV transfer vector having the CASI promoter, coding sequences for an anti-influenza neutralizing antibody, WPRE sequence and SV40 poly(A) can be used. Examples of such AAV transfer vectors include the vector given in SEQ ID NO: 25 to 27, 29 and 30.
A patient is identified as being at risk of developing influenza infection and administered an effective amount of the recombinant AAV. Recombinant AAV is given to the patient by intramuscular injection. Recombinant AAV expresses the F10 antibody in the patient, thereby reducing the risk for the patient to develop influenza virus infection. The appropriate dosage (ie, anti-influenza neutralizing antibody expression level) and treatment regimen can be readily determined by skilled practitioners based on a number of factors including, but not limited to, the route of administration and the extent of exposure to the virus. flu for the patient. A patient's influenza viral load can be determined at various points in time after the patient is administered recombinant AAV. The effectiveness of immunoprophylaxis is evaluated by looking at the reduced risk of influenza infection when compared to patients who do not receive any AAV treatment.
[00261] In at least some of the previously described modalities, one or more elements used in one modality may interchangeably be used in another modality unless such a substitution is not technically possible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications are intended to fall within the scope of the matter as defined by the appended claims.
[00262] With respect to the use of substantially any plural and/or singular terms, in this report, those having skill in the art may interpret the plural to the singular and/or the singular to the plural as appropriate to the context and/or application. The various singular/plural permutations may be expressly presented in this report for the sake of clarity.
[00263] It will be understood by those in the art that, in general, terms used in this report, and especially in the appended claims (eg, contexts of the appended claims) are generally intended as "open" terms (eg, the term " including" shall be interpreted as "including, but not limited to," the term "having" shall be construed as "having at least," the term "includes" shall be construed as "includes, but is not limited to," etc. .). It will be further understood by those in the art that if a specific number of a recitation of the claim introduced is intended, such intent will be explicitly stated in the claim, and in the absence of such recitation no intent is present. For example, as an aid to understanding, the following appended claims may contain the use of the introductory phrases “at least one” and “one or more” to introduce the recitations of the claim. However, the use of such phrases should not be interpreted to imply that the introduction of a recitation of the claim by the indefinite articles "a" or "an" limits any particular claim containing such recitation of the introduced claim to the modalities containing only such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (eg, “a” and/or “an” should be interpreted to mean “by minus one” or “one or more”); the same holds true for the use of definite articles used to introduce recitations of the claim. Furthermore, even if a specific number of a recitation of the introduced claim is explicitly reported, those skilled in the art will recognize that such recitation must be interpreted to mean at least the reported number (eg, the simple recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Also, in these examples where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construct is intended in the sense that a person having skill in the technique would understand the convention (eg, "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In these examples where a convention analogous to "at least one of A, B, or C, etc." is used, in general such a construct is intended in the sense that a person having skill in the technique would understand the convention (eg, "a system having at least one of A, B, or C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will further be understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to consider the possibilities of including one of the terms, any of the terms , or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."
[00264] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is thus also described in terms of any individual member or subgroup of members of the Markush group.
[00265] As will be understood by a person skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed in this report also cover any and all possible sub-ranges and combinations of sub-tracks of this. Any track listed can be easily recognized as sufficiently describing and allowing the same track to be broken into at least halves, thirds, quarters, fifths, equal tenths, etc. As a non-limiting example, each band discussed in this report can be easily broken down into a lower third, middle third and upper third, etc. As will also be understood by a person skilled in the art all language such as “until,” “at least,” “greater than,” “less than,” and the like include the reported number and refer to ranges that may be subsequently broken into sub-bands as discussed above. Finally, as will be understood by a person skilled in the art, a band includes each individual member. So, for example, a group having 1 to 3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1 to 5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so on.
[00266]Although several aspects and modalities have been disclosed in this report, other aspects and modalities will be evident to those skilled in the art. The various aspects and modalities disclosed in this report are for illustrative purposes and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

权利要求:
Claims (19)
[0001]
1. Viral vector CHARACTERIZED in that the vector is an adeno-associated viral vector and comprises: a promoter comprising the nucleic acid sequence of SEQ ID NO: 1; and a post-transcriptional regulatory element selected from the group consisting of a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element (HBVPRE), or a transport element of RNA (RTE).
[0002]
2. Viral vector, according to claim 1, CHARACTERIZED by the fact that it comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 7.
[0003]
3. Viral vector, according to claim 1 or 2, CHARACTERIZED by the fact that it further comprises a polynucleotide operably linked with the promoter, wherein the polynucleotide comprises an encoding region of a protein of interest.
[0004]
4. Viral vector, according to claim 3, CHARACTERIZED by the fact that the polynucleotide comprises a signal peptide sequence immediately upstream of the coding region of the protein of interest, wherein the signal peptide comprises the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
[0005]
5. Viral vector, according to claim 3 or 4, CHARACTERIZED by the fact that the vector comprises a Kozak consensus sequence comprising the nucleotide sequence of SEQ ID NO: 41 or SEQ ID NO: 42.
[0006]
6. Viral vector, according to any one of claims 1 to 5, CHARACTERIZED by the fact that the protein of interest is selected from the group consisting of full length antibodies, growth hormones (GHs), type growth factors insulin (IGFs), G-CSFs, erythropoietins (EPOs), insulins, Fab antibody fragments, scFV antibody fragments, hemophilia-related clotting proteins, dystrophin, lysosomal acid lipase, phenylalanine hydroxylase (PAH), disease-related enzymes glycogen storage, a malaria neutralizing antibody, and a virus neutralizing antibody.
[0007]
7. Viral vector, according to claim 6, CHARACTERIZED by the fact that the virus neutralizing antibody is a neutralizing antibody to a human immunodeficiency virus (HIV), a hepatitis C virus (HCV), or an influenza virus .
[0008]
8. Viral vector, according to claim 7, CHARACTERIZED by the fact that the neutralizing antibody for HIV is selected from the group consisting of anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, antibody anti-HIV 2F5, and wherein the neutralizing antibody to HCV is selected from the group consisting of anti-HCV AR3A antibody, anti-HCV AR3B antibody, and anti-HCV AR4A antibody.
[0009]
9. Viral vector, according to any one of claims 1 to 8, CHARACTERIZED by the fact that the promoter comprises a splice donor comprising the nucleotide sequence of SEQ ID NO: 5, or a splice acceptor comprising the acid sequence nucleic acids of SEQ ID NO:6.
[0010]
10. Viral vector, according to any one of claims 1 to 9, CHARACTERIZED by the fact that the promoter comprises an intron comprising the nucleotide sequence of SEQ ID NO: 8.
[0011]
11. Viral vector, according to claim 3, CHARACTERIZED by the fact that the polynucleotide comprises a first coding region for the heavy chain variable region of an immunoglobulin and a second coding region for the light chain variable region of the immunoglobulin.
[0012]
12. Viral vector, according to claim 11, CHARACTERIZED by the fact that the first coding region and the second coding region are separated by an F2A sequence comprising the sequence of SEQ ID NO: 9 or SEQ ID NO: 10.
[0013]
13. Method for producing a recombinant adeno-associated virus (AAV), CHARACTERIZED by the fact that it comprises: providing a packaging cell line with the viral vector, as defined in any one of claims 1 to 11; and recovering a recombinant AAV virus from the packaging cell line supernatant.
[0014]
14. Isolated, synthetic or recombinant polynucleotide CHARACTERIZED by the fact that it comprises the nucleic acid sequence of SEQ ID NO:1.
[0015]
15. Polynucleotide, according to claim 14, CHARACTERIZED by the fact that the polynucleotide is comprised within a viral vector.
[0016]
16. Use of a recombinant adeno-associated virus (AAV) comprising a nucleotide sequence encoding a neutralizing antibody to a virus, CHARACTERIZED by the fact that it is for the manufacture of a medicament for the treatment of a viral infection caused by the virus or for reducing the risk of virus infection, wherein the AAV comprises the nucleic acid sequence of SEQ ID NO: 1.
[0017]
17. Use, according to claim 16, CHARACTERIZED by the fact that the neutralizing antibody is selected from the group consisting of anti-HIV b12 antibody, anti-HIV antibody 2G12, anti-HIV antibody 4E10, anti-HIV antibody 2F5, anti-HCV AR3A antibody, anti-HCV AR3B antibody, and anti-HCV AR4A antibody.
[0018]
18. Viral vector, according to claim 1, CHARACTERIZED by the fact that the viral vector comprises the nucleic acid sequence of any of the sequences of SEQ ID NOs: 14 to 30 or SEQ ID NO: 40.
[0019]
19. Polynucleotide according to claim 15, CHARACTERIZED by the fact that the viral vector comprises the nucleic acid sequence of any one of SEQ ID NOs: 14 to 30 or SEQ ID NO: 40.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013021494B1|2021-09-08|VIRAL VECTOR, ISOLATED POLYNUCLEOTIDE, USE OF A RECOMBINANT ADENO-ASSOCIATED VIRUS | AND METHOD TO PRODUCE THE SAME

---

US20210108209A1|2021-04-15|Products and Methods for Treatment of Familial Amyotrophic Lateral Sclerosis

---

JP6212142B2|2017-10-11|Method for detection and / or identification of adeno-associated virus | sequences and method for isolating novel sequences identified thereby

---

JP2019513401A|2019-05-30|Novel AAV8 mutant capsid and composition containing the same

---

US20180311317A1|2018-11-01|Factor VIII Sequences

---

JP2005512533A|2005-05-12|Sequence of adeno-associated virus | serotype 8

---

van Lieshout et al.2018|A novel triple-mutant AAV6 capsid induces rapid and potent transgene expression in the muscle and respiratory tract of mice

---

CN108135994A|2018-06-08|The expression of the anti-influenza antibodies of AAV- mediations and its application method

---

Gao et al.2012|Exploiting natural diversity of AAV for the design of vectors with novel properties

---

KR20190135000A|2019-12-05|Influenza Vaccine Based on AAV Vectors

---

Konno et al.2020|Efficient whole brain transduction by systemic infusion of minimally purified AAV-PHP. eB

---

US20210388382A1|2021-12-16|Adeno-associated virus | delivery of anti-fam19a5 antibodies

---

Xie et al.2021|Apolipoprotein E, low-density lipoprotein receptor, and immune cells control blood-brain barrier penetration by AAV-PHP. eB in mice

---

EP3390623B1|2021-02-17|Wilson's disease gene therapy

---

US20190240328A1|2019-08-08|Novel humanized anti-ebola antibodies useful in preventing ebola infections

---

JP2021528639A|2021-10-21|AAV treatment method

---

WO2021169167A1|2021-09-02|Method for treating coronavirus infections

---

CA3130525A1|2020-10-15|Hybrid promoters for muscle expression

同族专利:

---

公开号 | 公开日

---

EP2678433A1|2014-01-01|

---

EP2678433B1|2017-05-03|

---

CN103492574A|2014-01-01|

---

US8865881B2|2014-10-21|

---

CN103492574B|2015-12-09|

---

BR112013021494A2|2017-05-30|

---

EP2678433A4|2014-12-17|

---

JP6091435B2|2017-03-08|

---

WO2012115980A1|2012-08-30|

---

JP2014511180A|2014-05-15|

---

US9527904B2|2016-12-27|

---

US20120232133A1|2012-09-13|

---

US20150010578A1|2015-01-08|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4937190A|1987-10-15|1990-06-26|Wisconsin Alumni Research Foundation|Translation enhancer|

---

US6410300B1|1998-01-12|2002-06-25|The University Of North Carolina At Chapel Hill|Methods and formulations for mediating adeno-associated virus attachment and infection and methods for purifying AAV|

---

AU6254799A|1998-09-16|2000-04-03|Tanox, Inc.|Anti-ige gene therapy|

---

US6428155B1|1999-05-25|2002-08-06|Silverbrook Research Pty Ltd|Printer cartridge including machine readable ink|

---

AU2001270252B2|2000-07-03|2007-02-08|Catalent Pharma Solutions, Llc|Expression vectors|

---

US7939059B2|2001-12-10|2011-05-10|California Institute Of Technology|Method for the generation of antigen-specific lymphocytes|

---

CA2481813A1|2002-04-09|2003-10-23|Children's Hospital, Inc.|Antibody gene transfer and recombinant aav therefor|

---

US20040156828A1|2003-01-07|2004-08-12|Ruian Xu|Adeno-associated virus mediated B7.1 vaccination synergizes with angiostatin to eradicate disseminated liver metastatic cancers|

---

EP1636360A4|2003-06-03|2006-11-08|Cell Genesys Inc|Compositions and methods for enhanced expression of recombinant polypeptides from a single vector using a peptide cleavage site|

---

US7186699B2|2003-06-03|2007-03-06|Cell Genesys, Inc.|Method for treating cancer by vector-mediated delivery of one or more anti-angiogenic or pro-apoptotic genes|

---

US7485291B2|2003-06-03|2009-02-03|Cell Genesys, Inc.|Compositions and methods for generating multiple polypeptides from a single vector using a virus derived peptide cleavage site, and uses thereof|

---

US7407801B2|2003-12-05|2008-08-05|University Of Iowa Research Foundation|Truncated CMV promoters and vectors containing same|

---

JP2008506389A|2004-07-13|2008-03-06|セルジェネシスインコーポレイテッド|AAV vector composition and method for enhanced expression of immunoglobulin and method of use thereof|

---

EP1807157A2|2004-10-22|2007-07-18|Neurologix, Inc.|Use of apoptosis inhibiting compounds in degenerative neurological disorders|

---

US7943374B2|2005-08-21|2011-05-17|Markus Hildinger|Super-size adeno-associated viral vector harboring a recombinant genome larger than 5.7 kb|

---

AU2006304268B2|2005-10-14|2011-09-29|The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention|Rabies virus vector systems and compositions and methods thereof|

---

WO2009120339A2|2008-03-24|2009-10-01|President And Fellows Of Harvard College|Vectors for delivering disease neutralizing agents|

---

EP2108706A1|2008-04-10|2009-10-14|Institut Pasteur|New method for selecting compounds useful for treating and/or preventing microbial Shigella infection|

---

US7943379B2|2008-04-30|2011-05-17|Nationwide Children's Hospital, Inc.|Production of rAAV in vero cells using particular adenovirus helpers|

---

HUE026796T2|2010-10-15|2016-07-28|Inserm - Inst Nat De La Sante Et De La Rech Medicale|Expression vector for cholesterol 24-hydrolase in therapy of huntington's disease|

---

EP2678433B1|2011-02-22|2017-05-03|California Institute of Technology|Delivery of proteins using adeno-associated virus vectors|DE60138535D1|2000-02-04|2009-06-10|Children S Hospital Res Founda|USE OF LYSOSOMAL ACID LIPASE FOR THE TREATMENT OF ATHEROSCLEROSIS AND SIMILAR DISEASES|

---

WO2010045659A1|2008-10-17|2010-04-22|American Gene Technologies International Inc.|Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules|

---

JP5925187B2|2010-04-23|2016-05-25|シナジーバ バイオファーマ コープ|Lysosomal storage disease enzyme|

---

PT2613798E|2010-09-09|2015-06-02|Synageva Biopharma Corp|Use of lysosomal acid lipase for treating lysosomal acid lipase deficiency in patients|

---

US9309534B2|2010-07-12|2016-04-12|Universidad Autonoma De Barcelona|Gene therapy composition for use in diabetes treatment|

---

US8822663B2|2010-08-06|2014-09-02|Moderna Therapeutics, Inc.|Engineered nucleic acids and methods of use thereof|

---

EP2625189B1|2010-10-01|2018-06-27|ModernaTX, Inc.|Engineered nucleic acids and methods of use thereof|

---

EP2675472A4|2011-02-15|2014-09-17|Synageva Biopharma Corp|Methods for treating lysosomal acid lipase deficiency|

---

EP2678433B1|2011-02-22|2017-05-03|California Institute of Technology|Delivery of proteins using adeno-associated virusvectors|

---

WO2012135805A2|2011-03-31|2012-10-04|modeRNA Therapeutics|Delivery and formulation of engineered nucleic acids|

---

US9464124B2|2011-09-12|2016-10-11|Moderna Therapeutics, Inc.|Engineered nucleic acids and methods of use thereof|

---

AU2012352180A1|2011-12-16|2014-07-31|Moderna Therapeutics, Inc.|Modified nucleoside, nucleotide, and nucleic acid compositions|

---

CN110511939A|2011-10-03|2019-11-29|现代泰克斯公司|Nucleosides, nucleotide and nucleic acid of modification and application thereof|

---

US9283287B2|2012-04-02|2016-03-15|Moderna Therapeutics, Inc.|Modified polynucleotides for the production of nuclear proteins|

---

US10093947B2|2012-02-28|2018-10-09|Cornell University|AAV-directed persistent expression of an anti-nicotine antibody gene for smoking cessation|

---

AU2013243955B2|2012-04-02|2018-02-22|Modernatx, Inc.|Modified polynucleotides for the production of oncology-related proteins and peptides|

---

US9878056B2|2012-04-02|2018-01-30|Modernatx, Inc.|Modified polynucleotides for the production of cosmetic proteins and peptides|

---

US9572897B2|2012-04-02|2017-02-21|Modernatx, Inc.|Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins|

---

US10004811B2|2012-04-13|2018-06-26|Cornell University|Development of a highly efficient second generation nicotine-conjugate vaccine to treat nicotine addiction|

---

WO2014052693A2|2012-09-29|2014-04-03|The Trustees Of The University Of Pennsylvania|Veterinary composition and methods for non-surgical neutering and castration|

---

EP2914731B1|2012-11-01|2019-09-11|California Institute of Technology|Reversible gene expression|

---

EP2922554B1|2012-11-26|2022-02-23|ModernaTX, Inc.|Terminally modified rna|

---

KR20210088741A|2012-12-13|2021-07-14|더 트러스티스 오브 더 유니버시티 오브 펜실베니아|Dna antibody constructs and method of using same|

---

WO2015089492A2|2013-12-13|2015-06-18|The Trustees Of The University Of Pennsylvania|Dna antibody constructs and method of using same|

---

WO2014120975A1|2013-02-01|2014-08-07|California Institute Of Technology|Antibody-mediated immunocontraception|

---

US8980864B2|2013-03-15|2015-03-17|Moderna Therapeutics, Inc.|Compositions and methods of altering cholesterol levels|

---

US20140287938A1|2013-03-15|2014-09-25|The Broad Institute, Inc.|Recombinant virus and preparations thereof|

---

US9597658B2|2013-04-01|2017-03-21|Savannah River Nuclear Solutions, Llc|Metal-organic framework templated synthesis of porous inorganic materials as novel sorbents|

---

WO2014186746A1|2013-05-16|2014-11-20|University Of Florida Research Foundation, Inc.|HAIRPIN mRNA ELEMENTS AND METHODS FOR THE REGULATION OF PROTEIN TRANSLATION|

---

WO2015048744A2|2013-09-30|2015-04-02|Moderna Therapeutics, Inc.|Polynucleotides encoding immune modulating polypeptides|

---

US10323076B2|2013-10-03|2019-06-18|Modernatx, Inc.|Polynucleotides encoding low density lipoprotein receptor|

---

US9884075B2|2014-01-16|2018-02-06|California Institute Of Technology|Domain-swap T cell receptors|

---

EP3119895A4|2014-03-21|2017-11-08|The Board of Trustees of the Leland Stanford Junior University|Genome editing without nucleases|

---

PE20170261A1|2014-05-13|2017-04-12|Univ Pennsylvania|COMPOSITIONS THAT INCLUDE ADENO-ASSOCIATED VIRUSTHAT EXPRESSES DUAL ANTIBODY CONSTRUCTS AND THEIR USES|

---

CN107043774B|2014-09-25|2021-05-04|中国人民解放军第二军医大学东方肝胆外科医院|Chimeric strong promoter and application thereof|

---

WO2016073693A2|2014-11-05|2016-05-12|Voyager Therapeutics, Inc.|Aadc polynucleotides for the treatment of parkinson's disease|

---

WO2016077689A1|2014-11-14|2016-05-19|Voyager Therapeutics, Inc.|Modulatory polynucleotides|

---

US11033638B2|2015-01-07|2021-06-15|Universität Autonoma De Barcelona|Single-vector gene construct comprising insulin and glucokinase genes|

---

US20180008727A1|2015-01-30|2018-01-11|The Regents Of The University Of California|Spinal subpial gene delivery system|

---

CN108093639A|2015-04-16|2018-05-29|埃默里大学|For the recombinant promoter of protein in liver expression and carrier and application thereof|

---

CN107530451A|2015-05-07|2018-01-02|南佛罗里达大学|The UBE3A genes of the modification of the gene therapy method of syndrome are made one for day|

---

US10016514B2|2015-05-15|2018-07-10|New Hope Research Foundation|Polynucleotides, vectors and methods for insertion and expression of transgenes|

---

US10266844B2|2015-07-31|2019-04-23|California Institute Of Technology|Activity-dependent expression of nucleic acids|

---

MX2018006840A|2015-12-11|2019-03-28|California Inst Of Techn|TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES .|

---

US10137144B2|2016-01-15|2018-11-27|American Gene Technologies International Inc.|Methods and compositions for the activation of gamma-delta T-cells|

---

JP2019501661A|2016-01-15|2019-01-24|アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド|Methods and compositions for activation of gamma delta T cells|

---

JP2019509029A|2016-02-08|2019-04-04|アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド|HIV vaccination and immunotherapy|

---

EP3426777B1|2016-03-09|2022-02-16|American Gene Technologies International Inc.|Combination vectors and methods for treating cancer|

---

WO2017180936A1|2016-04-15|2017-10-19|The Trustees Of The University Of Pennsylvania|Compositions for treatment of wet age-related macular degeneration|

---

US20190153471A1|2016-04-29|2019-05-23|Voyager Therapeutics, Inc.|Compositions for the treatment of disease|

---

US20190224339A1|2016-04-29|2019-07-25|Voyager Therapeutics, Inc.|Compositions for the treatment of disease|

---

WO2018009246A1|2016-07-08|2018-01-11|American Gene Technologies International Inc.|Hiv pre-immunization and immunotherapy|

---

WO2018022783A1|2016-07-26|2018-02-01|Cornell University|Gene therapy for the treatment of aldehyde dehydrogenase deficiency|

---

CN106434575A|2016-09-26|2017-02-22|中国动物卫生与流行病学中心|Establishing method of influenza virus as expression carrier|

---

CA3038292A1|2016-09-28|2018-04-05|Cohbar, Inc.|Therapeutic mots-c related peptides|

---

WO2018060288A1|2016-09-29|2018-04-05|Glaxosmithkline Biologicals S.A.|Compositions and methods of treatment of persistent hpv infection|

---

EP3538546A1|2016-11-14|2019-09-18|Novartis AG|Compositions, methods, and therapeutic uses related to fusogenic protein minion|

---

GB201620968D0|2016-12-09|2017-01-25|Glaxosmithkline Biologicals Sa|Adenovirus polynucleotides and polypeptides|

---

WO2018104919A1|2016-12-09|2018-06-14|Glaxosmithkline Biologicals Sa|Chimpanzee adenovirus constructs with lyssavirus antigens|

---

WO2018156892A1|2017-02-23|2018-08-30|Adrx, Inc.|Peptide inhibitors of transcription factor aggregation|

---

EP3589649A1|2017-02-28|2020-01-08|The Trustees Of The University Of Pennsylvania|Influenza vaccines based on aav vectors|

---

CA3057142A1|2017-04-03|2018-10-11|American Gene Technologies International Inc.|Compositions and methods for treating phenylketonuria|

---

CA3059891A1|2017-04-14|2018-10-18|National Taiwan University|Gene therapy for aadc deficiency|

---

EP3634978A1|2017-06-07|2020-04-15|Adrx, Inc.|Tau aggregation inhibitors|

---

WO2019016756A1|2017-07-21|2019-01-24|Glaxosmithkline Biologicals Sa|Chikungunya virus antigen constructs|

---

WO2019021233A1|2017-07-27|2019-01-31|Novartis Ag|Sheddase resistant trem2 variants|

---

TWI722310B|2017-08-03|2021-03-21|美商航海家醫療公司|Compositions and methods for delivery of aav|

---

KR20200066349A|2017-10-16|2020-06-09|글락소스미스클라인 바이오로지칼즈 에스.에이.|Replicable adenovirus vector|

---

WO2019076892A1|2017-10-16|2019-04-25|Glaxosmithkline Biologicals Sa|Enhanced promoter|

---

US20210189422A1|2017-10-16|2021-06-24|Glaxosmithkline Biologicals Sa|Adenoviral vectors with two expression cassettes encoding rsv antigenic proteins or fragments thereof|

---

AR114989A1|2017-10-16|2020-11-18|Glaxosmithkline Biologicals Sa|ADENOVIRAL VECTORS WITH TWO EXPRESSION CASSETTES|

---

EA202091509A1|2017-12-19|2020-09-22|Акуос, Инк.|AAV-MEDIATED DELIVERY OF THERAPEUTIC ANTIBODIES TO THE INNER EAR|

---

WO2019123169A1|2017-12-20|2019-06-27|Glaxosmithkline Biologicals Sa|Epstein-barr virus antigen constructs|

---

CN108103104B|2017-12-21|2021-07-06|北京锦篮基因科技有限公司|Gene medicine for preventing and treating choroidal neovascularization related eye diseases|

---

US20210277365A1|2018-01-17|2021-09-09|Adrenas Therapeutics, Inc.|Adeno-associated virus gene therapy for 21-hydroxylase deficiency|

---

BR112020016288A2|2018-02-14|2020-12-15|Generation Bio Co.|NON-VIRAL DNA VECTORS AND USES OF THE SAME FOR PRODUCTION OF ANTIBODIES AND FUSION PROTEINS|

---

WO2019199841A1|2018-04-09|2019-10-17|Cure Ahc, Inc.|Aav-mediated delivery of atp1a3 genes to central nervous system|

---

US20210388382A1|2018-05-08|2021-12-16|Neuracle Science Co., Ltd.|Adeno-associated virusdelivery of anti-fam19a5 antibodies|

---

US20210198691A1|2018-05-15|2021-07-01|Voyager Therapeutics, Inc.|Compositions and methods for the treatment of parkinson's disease|

---

US20210230632A1|2018-05-15|2021-07-29|Voyager Therapeutics, Inc.|Compositions and methods for delivery of aav|

---

WO2019222444A2|2018-05-16|2019-11-21|Voyager Therapeutics, Inc.|Directed evolution|

---

WO2019239311A1|2018-06-12|2019-12-19|Glaxosmithkline Biologicals Sa|Adenovirus polynucleotides and polypeptides|

---

JP2022500066A|2018-09-28|2022-01-04|ボイジャー セラピューティクス インコーポレイテッドVoyager Therapeutics, Inc.|Frataxin expression construct with an engineered promoter and how to use it|

---

WO2020077165A1|2018-10-12|2020-04-16|Voyager Therapeutics, Inc.|Compositions and methods for delivery of aav|

---

US20200148762A1|2018-11-09|2020-05-14|Avamab Pharma Inc.|Methods for regulating endogenous production of antibodies against infectious diseases|

---

CN113631225A|2019-01-18|2021-11-09|沃雅戈治疗公司|Methods and systems for producing AAV particles|

---

SG11202107761SA|2019-01-28|2021-08-30|Cohbar Inc|Therapeutic peptides|

---

WO2020243659A1|2019-05-31|2020-12-03|University Of Florida Research Foundation, Incorporated|Vector-based therapy for thyroid disease|

---

CA3140820A1|2019-06-11|2020-12-17|Glaxosmithkline Biologicals Sa|Mucosal vaccine formulations|

---

WO2020252136A1|2019-06-11|2020-12-17|Shire Human Genetic Therapies, Inc.|Adeno associated viral vector delivery of antibodies for the treatment of disease mediated dysregulated plasma kallikrein|

---

WO2021046155A1|2019-09-03|2021-03-11|Voyager Therapeutics, Inc.|Vectorized editing of nucleic acids to correct overt mutations|

---

WO2021081280A1|2019-10-23|2021-04-29|Shire Human Genetic Therapies, Inc.|Adeno-associated virus vectors based gene therapy for hereditary angioedema|

---

WO2021169167A1|2020-02-29|2021-09-02|Nanjing GenScript Biotech Co., Ltd.|Method for treating coronavirus infections|

---

WO2021247995A2|2020-06-04|2021-12-09|Voyager Therapeutics, Inc.|Compositions and methods of treating neuropathic pain|

---

CN111705069A|2020-06-19|2020-09-25|武汉纽福斯生物科技有限公司|Multi-neurotrophic factor combined expression vector and application thereof|

---

WO2022026409A1|2020-07-27|2022-02-03|Voyager Therapeutics, Inc.|Compositions and methods for the treatment of neurological disorders related to glucosylceramidase beta deficiency|

---

WO2022026410A2|2020-07-27|2022-02-03|Voyager Therapeutics, Inc|Compositions and methods for the treatment of niemann-pick type c1 disease|

法律状态:
2018-01-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-02| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-09-17| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-03-30| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2021-07-20| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-09-08| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 21/02/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161445449P| true| 2011-02-22|2011-02-22|

---

US61/445,449|2011-02-22|

---

US201161550123P| true| 2011-10-21|2011-10-21|

---

US61/550,123|2011-10-21|

---

US201261598728P| true| 2012-02-14|2012-02-14|

---

US61/598,728|2012-02-14|

---

PCT/US2012/025970|WO2012115980A1|2011-02-22|2012-02-21|Delivery of proteins using adeno-associated virusvectors|

---